Summary
Transcript IDgene_000003828
Gene IDTTHERM_00293300
Length282 bp
Sequence
CTCAAGCTTTTATTAGTTCCTGAAGAATTCAATTCCAGGATTAGTGATGAAACTATTAGGATAATTTCAGAAATATACATCGAAAAGCTAAACACTTTTGAAAGTAACTGCGAAAACTACTACCTAATTCATTTGGATAAGGTCTTTAACCCAGATGTACTCAAAATATTACCTTAAGATTTAAAAATTAGTTACAAAAAGGCACTTGTAAGGATTTTGGAGCTTAAATTTGATACTGAAACACAACTAGGAAAATTCAGCTATTTCAAAAATGATAGAGGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1506.1 L-2227.9 L-3178.3 S-048.0 S-331.3
S-628.5 S-939.6 S-1227.4 S-1521.8 S-2438.1
C-077.2 C-292.3 C-436.5 C-633.9 C-833.0
C-1040.0 C-1232.2 C-1425.7 C-1627.8 C-1823.2