Summary
Transcript IDgene_000003829
Gene IDTTHERM_00293300
Length1044 bp
Sequence
GAAAAGTTGATTTTAGTGATACTATGGTTAATTAATGGAATTAATTACAAAAAGACATACAATAGTGTCTTAGAGATTATATAAATTAACAAGTTGCTTCAGGATTCTTCACTAAATTACTGCACAAAATACCATCACCTGTTGATAAAGAAGAAGATGAAATCATAGCTTAAGAAGATAGTGAAATGGATCTTTTGGCAATAGAAGAAGCAAATGAAGTAATCGCTGATGCTAAAGAAGATGATGATGAATTAAAAAAGAATGGAGAAAATGTAGATGAAAGTGTAAATTAAGAAAAACTTAAAGATGAAGATTTCAAAAAATAGCAAGGATACAAAATAATAGAATTATAATCTAATCTCTAATAACTCAAGTATGTAAAGACTATCACATATAATTCTCGTATTTAATTTAATTAGACTATCCTCTTAAGAAATTTCATCAACACCATTGAATGTGTTGCTTAGAACTTATACTTAAGTGAACCAGATGAAGAGTACATTCATTCCATCAAGTTATTAGTTAAGCAAGATAAATTAATTGAAGTTTTTGATCATTTTTGTATGATTCCTTCTTTCCTTGAAAGCTTAATTATGATAGAAGCTTATGGAAAGATTAAAAAAGGATAGTCATGGTTGAGTCCAGAACTTAGCAACAAAGTTCTAAAAATGAAATTCTTTATGGAAGATTTCTTTAATAAGGATTAAAATTATAAAGATAAAGCTCCTTCTAAATATATCAAATAAATAGAGTAAGAAGTGCAAAGTCTCCCAACTCAGAACCTTCCATTTGACAACGCATATGATTAGCATAATTTCATTTATGAAATCATTAGCAACTCCTTTTAGGTTTCTAATACACTTTTTGAGATTGAAAAATAAAAGACAAGCGTTATAGCAGAAAATAAAATAAATATGTAAAGAAAAAGAGATTTCTTGACAGAGCAATTCGTCTATAATAAAGAGAATCTATTAAGAAAGATAATCCATTCTTAAATTTATAGTTATTTTATCAATGAATCTCATTTAAAAAAATATACTGGTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,982.3 L-22,040.3 L-31,281.4 S-0177.0 S-372.8
S-670.6 S-968.6 S-1274.4 S-15106.3 S-24142.2
C-0216.9 C-2110.4 C-4142.6 C-669.7 C-8132.0
C-10298.3 C-12119.0 C-14104.3 C-1671.7 C-1898.0