Summary
Transcript IDgene_000004043
Gene IDTTHERM_00309880
Length2819 bp
Sequence
GTAGTTATATGAGTCCAAAAAAAGGCAAATACTCAAATAATGAAATATATAAATACTATATATCTTATGGATATAGCCAACTTCCTGAAGTAATTAATGAATTTGAGTATGAAAAAGAAGAATCTACATTAGACAATAAAAGGTTTACTTTTTCCAATTAGCAAGAGTAAAAAGCTGAATAAGCTAAATTGCATGACAACCCAGATAATATTAATTATGAATAGTTAGATAAATTTTTCAACAATAGAGAACCAGAAAAAGCACATAGAGGAAATGTCAACAGCCAATCAAAAGAAAAGTAGCCTAGATTAAGCTAACTTGCAAACATAGCTAAGTATAAATTCAATACCTAAGAATATGTCAAAAAGCCAAATTATAAAAGTGAACTTAATGAAGATTAGAAATAAAATCACATTTCAATTTTTCAAGGTAGACAAGTTAAGTTAGCGAAGCAGTAATCAGAAGATTTGAGTTTTGTGAGTAGTTAGATAGATTTGTAAGAAAGTCCTCGAAAAAAGTAAGATGGTCAAATTAAACTAAAAAATTTAGATTAAGCTTAAACATCACAAAAACAGTCAGAAAATTAAGTGAAAAAGATAGAAGCCACTGAAACTATTTCTCCAGTGAAAAATTAAATCAATTTTCCTTATTCTCCTTCTCAGTCATTAAGTTTTCATTAAGCGAGTAACCAAAAAGGATAAGAGCTTCTAAGTCCAAGCTAGCAAAACGTTATTCCATAATTTAATATGGATGATATAAATTTTCAAAATACACCTTTGAACTCCAAAGTACAGCATGCTGTATTTGGTGAGGCTGCAAATCAAAATCATAACATATACTAAAACAATCAATATTATTCATTAAATTATGATAATTCTATGCAGTATCTAGCAGGTGATAATAGTAAATAAAATAATATTGATTCCTAAGTAATGAGCCCTCAAGCAGCTGTAGCTACAACTTTTTATTAAGATAATTAGCTGAATAATTATCTTTCTCAAAGCTAAATACTAACTCCTAGTAACAGCTAAGGAATTATTCCATAACAATATGGGCTATTAGGACCTTAATTAGATTAAAATATATTTTAAAATCCAAGTTAAAGTAGCTTAATGAATATAAGCAACTTAAATATAACAAATGTTAATAATAATTTTATATATGACAATAAATAAATTTAAAACTAAAAGAGCTCGAAATTTTTTAGTTCTAAATTAAACTAAATGTCACAGTTGAAAAGTCTACGCAGTAAAGTCAGTTCAAATACACAGCCTAATTTCATTTAACAGTTTTCTACCTTAAATCCTGGAAGTAATGACCCTTCTAAAGAATTTTCAGGATAATCATAAAGCAAGGATATTGAAGATACGAAAACAAAAAAAAAATAATACATAAATATCTAAGATGCAGTTGAATCTTCTTCTACTCACTCAAAATTGTCTAACATATCTTCTTAAAAAAAGCAAGTTAATCACATAATTTTTAGCACAAAAGATCTAAATGCAATGAAAATCATTAATATTTTTGGTTTCCTGAGTATATCAGTAATTATATTTGTTACACTCTTTTAGTATTATCAAATAATAACTACATTTTAAGACTTTGAATCAGATTGTAATATATCTGATGTGCCTACAAGGTATGTTTCTAATATGGCATATATAGTTTATGGAAAGAGTTTTCAATTTCTGCTTTAAAACAATTTCTTCACCTTAACTGATATTTAAGTTTAACAAGAATTATCTAATATAAAGTAAGTGTATAATAACACATTCACTTAATAGCTGTCTATGCTAATTTCTTTAAGTATCCCATAGCCAACAAACCAATTAGTATTTTATCTGATCGATGGCTAATATATTGCTAATTTATCTTCTCTTTATGGAACGGATAGCAGTCTTGTTGGAGTTAACAGCAATGATTTAAATAATTACAAAACATATAATTATGCTACTAATGTATTTTATGGTTGCATTTTAACCTTCTAATACTTTTTTCGCTTTGTTTATGGGTCAGGTAATCCAAGATCTACTTATATTGCATTATCAAATCAAGACAGATTGTAAGTAGAGCTACTAAATTTATTTAATTAATCAGAACAGGATCAGCTAGATTCAATAACTGTAAATCGTGATTTAGTTACAAAGCTAATGGTTTTGATTTTAATTATATGTCCTTTATGTGTATCAATTGTCTTACCTCTTTATGCATACATATAAACCAAAAGACAGGAGATTTTAATGCTGTTTGGAACATTCAGTATATAGCGTCTAGATTAGTGCATGCAAGATACCAAATTCACCACTTTCTACTTATTTGATATTAGCTCTAATTAGGCCGCAAGTTAAAAATAAAATGTTTAAAGGTAGTTGCTAAATAGTAAAGAGACATAAAAAAAATAAACACTAAGTTCATCAACTCCCTTACCAAAAATATCATTAGTCCTTGTTTTCTTAAGTATAGTAATAATTCTCTTCACATTACCTTATCCTATAGCAAATTAATAAATATCTTTCAGATTTATAGATTAAGACAGTTTAACACTTTAGCTTAAGCTCGAATTATCATAGCTTCGTATGAATATTCTAGAATCAGTAAGCAGTGCCTATTACTCTTTCTATTTAAAGATTCATCCAGAATTATAGAAATAATATAATATAACCTATTATATGACAAAACTTTAAAACTCAACCTCAAATATTGGATAAACGCAGCTACAAATTTAATCTTTATTTAATTAAATCTCCTTATAAAACATGTTTTAGCAAGATTTTTATAATAATTTCATTCCTAGCTACTTTGAAAAAAGCTTATGTGGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1211.0 L-2223.6 L-3192.4 S-0287.5 S-3335.7
S-6198.6 S-9269.2 S-12308.9 S-15303.0 S-24385.0
C-0448.9 C-2225.1 C-41,513.2 C-6807.5 C-8545.4
C-10219.7 C-12369.8 C-14419.0 C-16351.4 C-18454.6