Summary
Transcript IDgene_000004066
Gene IDTTHERM_00310820
Length644 bp
Sequence
TAAAGTAAGGTGTAAAGATTTTAAGCATGAATATTATTAAACCAACCATTTTCACTTTATTTGAAAGTGATGATAAGTTTTAGCAATTTGTTTAAGATATCATAAGTGAGTTTGTAATGGATAAGAAAAAACCATTAGTTCTTAAGTATGAAGAAATACAAAATTATTCTCAAGTGCTAGAAACACACAAGTTTTTATAAGATTTAGGAAATGTTATTATAGATAATACAATTAATTCAGCTAAAAATCTTAAAAAGTTGATTTTAAAATGCGATTTAGGAATTACTGAATAAAGAGTGAACATTTTAGCAGAAATATTATATTATAATATATAATCAATTCAAAAGTAGTCAATATAAAGATAAATAGCCTTAAACTAGCTTGTGTTAGTTGATTTTAATTGGAATATAAATGTAAGCATTGCAGCAGATAACCTATCAAGAACTTAAATTCCTTTACTAGTACTCCAACTCATTCTAAAGAGATATGGTAGTGAAAAGGAATAAAGAGTTAATCTAGAGTTCTCTAAAGAAGAATTAGAGGCATTTTTGAAAAAATTAAATAAACTAAAAAATGATATATTTAATTTAGATATTTAGCAATGAGAATTAGATTTATTTTTATTCTTTGTAAAAATTATATTT