Summary
Transcript IDgene_000004080
Gene IDTTHERM_00188470
Length1204 bp
Sequence
AACAAAATAAATCTAGATATTAAACACATTTCTTAATTCAAATGGCAGACAATAGGGAAAAAGTTGATTCAAGAAAGCTTTACGAAGACTAAAAGCTACTAGATATTTTAGAATAGAGAAGTTTATAATAGGATTAATCTTATCGTGAAATCTATAAAAAATCTCATATTCTTTAAAAGCAATCCTAATTTTAGGATGATAAAATAGTAAAATAATCTGAGCTTGATGATCTTTTAGGGAGAATTAAAAAGGTAGAAAAATTAAGACAAGAATCAAAATCATACACATGGAAGGATCCTCAATATTATCATGCTTTTATTAGAAAAAATTTAGATTTAGCTAGCAATTTAACCATGGAAACCATTTGTCTGCTAGTTTGCTATCCTTTCAATACAATTAAAACAAGAGTATAAGCAAAACATCCTTTAGAAGATATAAGCTTTTTTACTAAAAATAATGTTTCTAAATACCCTTTATATAGAGGTATTGGATAAGGCATGTTGGGAACTTTTATTGGTGTTACAATGAATAATGCTGCTTACAGATGGATAAATATTGAAATGATGAAAAATTAATTTGTTAGCAATTTGTCTACATTTTAAAAATAACTTATGTGTTTTTGCTTTGCAGATCTATTAGCTGCTCCTTTCAGACTTCCTTTTGAAGTCCGTAAAATATATCTCCAAATGAATTCTGGAGAAATAAGCTTTAATAAATATATGAATGGAATGAGATCTGTTTTATTGCCATGCCTTTTAAGAGATTTGACATACAGAATTGGTTTTAATACAGTGTTTTAATTGTGCCTTCATGGTTAAAATTATGCTTAAATGTACTCCAATAATGATCCTTATTAACGTTAATTAATTTAGAGACATATAGATAGGGCTATTCCAAATTAATCTGATTACAATAAAAGAATCACTGGTATGATTTTAGGATCATTATTTGCTATTTTGATTAGCAATCCTTTTGATTTAGCAATTACAAGATTAGTAAGTTAATAATATCCTAAATATGATGGATTCTTCCACTGTTTAAAAACAGTTATTAGAGAAGAAAAATGGCCCAAACTCTTCTTTAGTGGATATTGGGCAAGATCAGTTTATTACATGATATCTGGTTCTATTGTTTTTAACTTCTATGACACCTTCAGAGGTATGATAGAAGAAGCTTATTAGTATTGAATGAAAAATAAAATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,407.4 L-22,247.1 L-31,774.4 S-0524.8 S-3137.6
S-6164.9 S-9197.0 S-12143.5 S-15189.0 S-24202.7
C-0143.6 C-2321.7 C-4169.0 C-698.2 C-8171.2
C-10274.1 C-12297.5 C-14147.3 C-1698.6 C-1865.7