Summary
Transcript IDgene_000004092
Gene IDTTHERM_00188860
Length902 bp
Sequence
AGTATCAAAAATATTGCAATAATTAAAAATTTAATTGATTTAGTAGATTAGAAAGTAAGTAAGAATGACTTCAACTTAGGTAAAATTACAATAGCTTGACTTGTAAAGAAAGGATATAGAAACATAAATTAGCGCATTAAATAAAGAAATTAAGTATTATGAAGACAAAAATTATAACAAAAGTTTAGTTGATGAAGAAGGTTTTCCAAGAGCTGATTTAGATTTTGGAGAATTAAGCACATACAAAAATCTCAAAAGAAAATTTAATGAATTAAACAATGATTATAAAGGCTTAATGGTAGAAATAGAGAAAAGTTTAGGTGATTTACATGAAGAATACAGAGAAAGTGGATAAGCCTAAAGGGATTTAGAAGAATATGAAAAGAATATGGAAATAATGAAAAAAACTGAAGCTGCTGAAAAAGCTAAAAAGGAATATGATGAAGATATGAAAGATGAAAATTTAAATGCAGAAATAAAAAAAAATATTTTGATTCCATTTGCTTATATAAATGAAGTAGTAGATTAATCTCCAGCATTTTAAGCAGGTGTTAAACTAAACGATTTAATTGTTTCTTTTGGTCCTGTAAATCATTACAATCACAAGGAATTATAATTTTTGATAGAAACTGTTAAATCGAATGTCAACAAAGAAATTCCAGTCTAAGTATTAAGAAAAAATAATAAAATATAATAGTCTGAATAATTTTACTACAAGAATGAAAATTACGAACTAGTAAATTTAACTCTCACTCCTCGTACATGGAGCGGTCAGGGAGTCCTAGGGTGTCGCTTCAAATTAGTTTGAGTTAATAAATTTTGTTATAAAAATTGAACGAAATACTTAAAAAATAGATTAAAAATATAAATAATGTTGTGTTTATTATAAATATTTATTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1995.4 L-2732.2 L-3694.3 S-01,640.8 S-3736.8
S-6823.1 S-9769.3 S-121,177.0 S-151,356.5 S-241,032.4
C-0283.9 C-2309.6 C-4746.0 C-6313.1 C-8355.2
C-10516.7 C-12576.1 C-14495.8 C-16550.2 C-18443.6