Summary
Transcript IDgene_000004190
Gene IDTTHERM_00192090TTHERM_00192100
Length1464 bp
Sequence
AAAAACAAACAAACAATAAATTAAATAAAAACACAATAAAGCTTTAAATAGAAAAATTAAAAGATGCTCTCCAGAATTCTTACTAGACACTTCTCCCTTTGGGCTGGCGTTCCCAAGGCTCCCCCTGATCCAGTTTTAGGTGTTGCTGAAGCCTTCAAGAAAGACCCTGCTACTAATAAGGTTAACCTCTCTGTTGGTGCTTATAGAGATGATAATGGCAAGCCCGTTGTTTTAGAATGTGTTAGAAAAGCTCAATAAATCGTCATTGAGAAGAATCTTGATAACGAATATTTACCTATCTAAGGTAATGATGTATTCACTCATGCTGCTTTGAAGTTAGGTTACGGTGATGCTTTTTACAGTTCTAACAAAGATAGATTAGCTGGTGTTCAAGTTCTTTCAGGAACTGGTGCTTTGAGAACAGGTTTTGATTTCTTAAAGAAGTTCTTGCCTGCTGAAACTACTGTCTACGTTCCTAATCCTACCTGGCCTAATCACAACAATATTGCTCGTGATGCTGGCTTTAAGGTTGAATTTTACACCTACTATGATCCTGCTACCAAGTCTGTTAACTTCTCAAAGCTTTTAGATGAAGCTAAAACTTTTAAGAATGGTTCTGTTTTCATTTTACACGCTTGTGCTCACAATCCTACTGGCTGCGATCTCTCAATCAATCAATGGAAAGAACTTAGAGACGTTTTCCTCAAGAAGAACCACATTGCCTTCATGGATATGGCCTATCAAGGTTTCACCAGTGGTGATTGTTAAAAGGATTCTGAAGCTGTTAGACTCTTTGCTGATTCTAATGTTAACATGCTTTTGGGCTAATCCTTCGCTAAGTCTATGGGTCTCTATGGATAAAGAATAGGTTCATTATCCGTTTTGACTCAAAACGCTAACGAAGCCTAAAACGTTCTTTCATAATTAAAGTAAGTCATTCGTCCTAATATTTCTTCTCCTCCTCTTCACGGTGCTAGAATTGCTGAAATTATTTTGACTAATCCTGAACTCTTACAACTTTGGTACAGAGAAGTTAAGATTATGGCCGACAGAATCGCTTAAATGAGAGTTCAATTAGTTAAGAATTTAAAGGATGTTGGTTCTCAACACGATTGGAGCCATATCACTAACCAACGTGGTATGTTTGCTTACACTGGTGTCAATAAATAATAAGTCGAAAGTTTAATCAACGACTACCACATCTATTTGGTTGGATCTGGTAGAATCAGTATTGCTGGTTTAAACACCAAGAACGTTGGTTATGTTGCTGAAGCCTTCCACAATGTAACTAAAAATTCTAAAGTCTGAGAAATAAAAATACTTATTTGTATATTCTTACTACTTATATTGCATAAGAGGAAATAAATAAATCATTAGACCTCTGTTAAAATATCTGTATTTTACATGCTCATTTATGTTAATATGTTAAATAATTCGTTTTTTGCAACTTTAAGTATCTCAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-118,654.7 L-219,988.1 L-324,361.0 S-020,701.7 S-317,604.2
S-611,342.5 S-98,494.6 S-128,043.2 S-158,676.8 S-246,496.9
C-06,256.8 C-21,720.9 C-44,811.0 C-62,549.2 C-84,575.2
C-105,568.8 C-124,455.2 C-144,794.6 C-165,759.1 C-185,105.9