Summary
Transcript IDgene_000004235
Gene IDTTHERM_00138050
Length720 bp
Sequence
GTAAAAATCAATATTCTTTTAGAAGTTATGAGTTCATAAAGTGGTTAGTAATCAAATAGTAATTTGAGTGAAAGATAGGTCTTTTAGGAATAAGACGATTAGAGAATCACAGGAGATGATTGGAAATTAGATTTAAGTTAAGAAGATAGGGATCTCGCTAATGAAGTCGAAGATAAGTTGAAAGAAGTATAAAAACAAATGGAAATTATAGAATAAAAAACAAAAATGCTCTAAAACAGAATGAATTTCCCATTTGGAGGTTCTGGAAGTATGCCAAATATGGAATAAATAGTTGACAAGTAGAGATAAGAATAGTAATAGACTTCTGATTCTCCAGAAGCCATGCCTATGCCACCTAAGATAGATTACAAAGATTTTCCTGTTATAGATTCAAGAGGAAACCTAGTTTAAAGTAGAGAACAAGTCATAGAAAGATACCACAATTCTCTTCCATTTATCAGATGTTTGGAATTACCATTCTGTTATGTATAAATTAAAAAGAAAATTTAATTTTGGACAGTGTCTTCAGTAGGCTTGAGCTTATTATATAGTTCCTTCTATTTAGTTAAAGATAGAAAACCCTTAAAGACAATATAATTTAAACCTGTAATTAAACATGCTGGGCTTATATTTTTAGTAGGATCTCTATTTAGCACTTTAGAGACTATCTATTTTAACGATTATTGTGATATTAACAGCTATCATTATTAGGATAACAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1802.2 L-2787.2 L-3538.8 S-0101.0 S-336.5
S-637.2 S-946.9 S-1244.2 S-1549.9 S-2442.5
C-044.9 C-255.1 C-435.6 C-658.4 C-857.5
C-10151.0 C-12114.6 C-1458.1 C-1641.2 C-1842.0