Summary
Transcript IDgene_000004242
Gene IDTTHERM_00137990
Length1936 bp
Sequence
AATTAAAGAAAGAAAATAAATTAAGAAAAAAAGAAAAAATATTTGTAAAAGAATGATTCACTGTTTAAGAAACATTCGTACCGTCTCAGCCCTCCAAAGCAAGATTTCTTACAATCTTGGTGGTGGTAATAAAAGAAAGAAAACCTCAGGTGACTTGGATAATTATGATGTCCTTTTTGTAGGAGCTAATCTTGGTGGTATCTGCAGTAATCACTTCGACAAGGACACTCACGGTAAATACAAATGTTTCGTCTCTTTCGATCAACCTATAAATCAAATCTACTCTGTTCGTATTCCTTATGAATAATAAAGAGTCAGAAAGAGTGAATACATACATTTCTCCAAAAAATCTATCAATCAATTCACTCCTAGTGAAATGTTAGCAGTTAAGGAAATTTTACCTGAATAAAACGCTGTCGTTTTGAGCAGTGGTAGAAGAATCGGATACAACTAATTAGTTCTTGCCACTGGTCTTAAGCACGATTTCTCATAAATTAAAGGTTTTTATGAAGCTCTTGAACACCCTGAACATCCCGTTTACGCTAACAGAGATCCCGAAACATGGAGATCTGCTTAACACAAATATTCTAAGTATATTTCTAACTTCAAGAGTGGTGATGGTTACTTCTGCATTCCTGAATACCCCTATGCTGGTGAAGTTGAATGCTTCAACTTCTTCGTTTCTGACGAAGTATGGAAATGGGCTCAACACCATGGTGCTCTCTCTCCTAAGCACACTTTCACTATTGTTAATGCTAACGAAAAGTTTGTTCACTATTGTGACTCTGCTGATGCTTTCATTAAGGAAAGACTTGAAAAGAGAGGTATCAGAGTTGAATACAACACTAAGCTTCTCGAAGTTCACCAAGATGGCTAAAAGGCTACCTTCATTAACACCAAGACTGGTGAAAAATCTGTTAGAGATTACAATAATTTATATTCTATCGTCCCCTCCAAGAGACAAGAATTCTTAGATAAGGCTGGTTTGACCAACGGTAACGGTTTGTTAAACGTTGATCACTAGACCTTGTAACACAAAAAATATAAAAATATCTTCGGTTTAGGTGATGCTGCTGATTTACCTACCACCAAGACTTTCTGGGCTGGCTGGTACTAAATCGCTGTTGTCAGAAACAACGTCAAGAGAAACCTTTAAGGTTAAACCTTGAATGCCCATTATGATGGTTTCTCTAAGGTTCCTCTTTTCACTGGTCACCAAACCCTTACTTACGTTGCTCACTCTTACGGTGGTGTTGGTAACTGGTAACATCTCAAGCACAACAACGGAGGTATTCTTGCTTGGATGAGATATCGTTCTTGGGCTAAGGGTATGGCCAAGAAATTCTAAGATTTCTACAATGGTGCTAGATTAGGTCCTCCCTACCACAAAGTTTTAAAGAGTTTCCCCGAACTTCCTGGAAGTCCCGAATCATAATAAAGCTCCGGTATTTCAAAGTACTTCCCTACTAAGACCGAAAATAAAGCTGCTCATTGAACGTTTAAATAAAAAATTTATTAAAAATTTAAATAACTTAAAAATCTATTTAGAGCATACTCCGAATAGTAGAATAAAGAATGCGAGTTTCTATTTATTTGTGAATATTACTTGAGTATACTTATGAAAAATTTCTTCTTATAAAATTAAAATTTAAATCTTATTTATGTTCATTCTAATTAACTAAAAAATTATGGTAAGACTAGCTGACTAAATCACCCTCACACACAATAACTATCTAACTATCTATCTGTCTATCTATTATTATTTTTCAAATATTTTAACTCAAAATAGGAATTTGTTAAAAATTTCTAAAATAATAATGTTATTGCAAAGCAAATAAATAAATAAGTAAATAAGTAAGTAAGTAAGCCTATAAGTTAGTATTCTAAATAAATTTAAATATGTATTCTTGCTTTTAATTTTCAAATTAATTATCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-131,969.0 L-234,704.8 L-333,539.5 S-026,343.9 S-318,587.8
S-69,022.9 S-99,961.8 S-1210,990.7 S-1511,148.8 S-249,609.5
C-08,164.0 C-27,608.2 C-410,257.5 C-610,837.5 C-814,296.2
C-1012,034.4 C-1212,016.3 C-148,308.2 C-168,563.5 C-187,767.4