Summary
Transcript IDgene_000004316
Gene IDTTHERM_00133730
Length1285 bp
Sequence
AAAATAAAAAACACCAAAAAGATTAAAAAAATCAGAAGTAAGAAAAAATACAAATATGAGTCTGAAAACATATATCAATAAGAAGAAAAGCTAAAACTTAGGTTCTTCATAGTCATCGGCTGCAGCTCTCACATCACTTTAGTCAAATTGCTTTACAGCAAAGGGATAAATGGTTTCTTAAAATAGCTAGAACTCACAGAATACCATTCAAATGCAGTGCAATACACAAACTCAGTAGATACTCTCACAAGCTTCATAATTTCCTGTGCCTAAAAACTCTAGCCTTATGATTGAAGAACCAAATATCTTTGGATAAACTGGATACAGCTCATTCAAAAATAAGAACCTAAATTCTACTTAGAATACATCCTTTTTAAATTAGTTATCCTAAGACGAAGCTAATGATTCTTACAATTAAATTCTACATGAGAATAATTTTATTTAAAATCCTAATCTGAACTAAAGCTTTCTAAATTAAAGCTATCAACTTCTTTCATAGCATAACCTAAAGTAATCACAATTGTTTCTTCCAGCGATCCAAGAAAGTAAGGTCTCTTAATTTGATGGTAAGTCTAGCTAGATATTTAATCCTTCTGAATCAAGGCTAAATCATCCTAATCTGATATAAAGTAGCTTGATGGTTGGACAAATTTCTTAGTAATAATAACTTGCAAATATTTCGCTGCAGCTCTTATAAGATGAAATATTGAAATAAAAGATTGAATAAAGAGAAAGAGAATTAATCCTAAAGCAAGAATTGCTATAAGAAATGAGAGATTTAAAACACTTTTTCTAGAGCAATGTAATTAAATAAATAGAAGATAAAAATGAATAAATGCAGGGTGAGTGTTAGAAGAGCATTGAAGAAGTTTAAAAAAAGGTGGAAAATGTTGTTAAAACTATTTTTGATTACATCAAAGATGAAAAGCAAGAGGAAAAAAAGAAAAACTCTGTAGCATAATCAGACTATGCATAGGATATTTCAGATTTATATAATACTGTTAATTCCATTAAAGGAAAATTAGATAAAGAAGGTTTAAATCAATAATTTTAACAAGATTTGAATAAAGCTATAAAGATCATATTTAGTAAAATCAACTCTGCAAAAAGATCTGTAAAAAAACAGATTGTTCAAACAAACATGAGTCTAAGGAATAAAAGGAAAAAGGCAACCTAAACTTAAAATAATTGAATTTTAATATCAATTATTTTTTAATAATATTTTTTAGTTATATTTTTGTGGATTGTACAAATAAACTAAGAATAAATAACAAGAATAAAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-142.2 L-245.9 L-337.7 S-088.6 S-391.1
S-679.0 S-971.9 S-1274.3 S-1580.6 S-2474.4
C-055.4 C-226,495.2 C-44,980.1 C-62,077.0 C-8549.6
C-101,086.7 C-122,594.9 C-14750.3 C-16181.1 C-18110.2