Summary
Transcript IDgene_000004369
Gene IDTTHERM_00129420
Length3038 bp
Sequence
GTAAAAAGAAAAATATTATATTGTAATTAATTACTTGAATTAAATTGATCCTAGCTTTAGGTTTATTTCATTTCCAATTATAGATCCAAAAACATACAATGCCCAGCTTAGGATAAATCATGTAAAAACTCTTCCAACCCTTACCTTCTACAAAGCAATGGAAAAAGAATTGAATGCAGTTATCAATAAGGAATTTACTTCAAGCTAAGAATTGAAGCAACTAGCTTTGAGGTTAATTAATAATCTAAAATAAGAGAGAGAAATAATGGAATACAATTAGAAATTAAGATAGGTCTAAATTGAGGCACAAAGAGATTTGAAGAGGATATTTTTGAAAGTGAAGGAAATCACTCAAAATATAGAGAAGAATTTAAACTTGGATAAGAAAGCAGATTTTATTGATAATCTATTTAACAACATAAAGCAAATAAATCTTATCATTGGAGAAGCTTAGCTTATTTACTAGTCATTGCTATAAATAGAAATTTAAACTTCAATTGATTTGACTCATTATATTGGACTATTTAGCGATGAATAAAACTCTAAATTATTGATTGCTTTTGGCTATGATGAAAATGCTATTGAAATGATAGACTTTTTAGATCATGTAATTGATGTTTTAGAAGATTGCTATTAAAAATGTAAAGAGGCAACTGAAGAATAAGAAGCTTCTAAATCTGCTTTTTTAGCTTTGTAGATGGAATAGACTTTTAGTGAAGGAAAAGAGTATTTTTAGGTTACTAATTCCTTATATCATTAATTATGTGCATATATATATCTTGAGTTTCAGAGAATGATTAAATATACAAGAGAAGAGCTCAAAAAATTAGAGCCTTATTTAGCTAAAATCAACAAAAACATATGTGAAATTTTATATCTCCATTTTATTAAGAAAAGAGAAACAGAAAAGATAAAGGATGAGTTTTAAGGATTGGTTAATAGAATTAAAGTGGGAGTTAAGGAACCCCTGAGAAGCAAAGATAATGAAAATTTGGTTAAAAGTATAGAAAATGAAAGCAACAGATTGCTTGATGAGTTGAGAAGCTGTAAAGAAACATATAATTTATATACAGCCGAATGTTTTACAGTGTTTTTTGAACATAAGAAAATGAGGAGAAAGAAGGAAATTAAATAATTAAAAAATGACATTAGATTATTTTAGTAAACTCTTAAATTCATTAGAGAGATTATTGATAGTGAGGAGCCCTTGGATAAAAATATGAAAGATTCTTAAAATTTTATGAAGTTAATTGAGGAAACAAAAACTAGATTTGAAAAAATACAATAGAATAAAACAAGAAGTAAATTACCTCATTAAAACGAAGAAATTAATAAAATTAGGAACGAAGCAAAAAAAATATATCTGTAAAGCGAAGACTAAATAGTATAACTCTAATAGTACATAATTAAATTCGAGCAATACTATAATGTAAGTTATGTAAGCATATTCGAACATCTATTTGAAAAAAAGTACATCTAACTTAAGAACACAAGAGAATTACTGTATCAAATTTAGGATGCTATTATTGAAATGCTCAGCTAGGAGTCTAAGATTTTGAGAGTAGATTGTGAGTAAATTAGAGACGAAACTGATTCATTGCTTAAAGACATATTTGTTTTCCTAGATTCGATTGATGCTAAATTATTGACAAGGACTGATAATAAGTATTTATTGGATGATATTGGTACGAATATACTAAAACTACTTATGAGATTGAAAAAGAATCAAGCTCAAATAGAGATTAATTTACAAGATGAAAGCTTGATTATTTCGTATGAATTAAGCTCTGAATTAAAAAAAATGGGATAATCACTGTCCATCCAGCTTACTAATTTAGAGGCGCTTGGAATCATAATAGAAAGCAGATCATACTTTAATTCCCAGCTGATAGTAAATACTGTCTATGAATTTATGGATAACGAACCGGAATTTAAGGTTCTTGATTCGATGCTCAAAGATTTGCCAGCCCATAAAAAAGATGTTGAAGAGTTTATCTCAGAGTACTAATAGAAAGTGAGCTCTTAGTTACTGATGTTATCAAGGGCGAGAATAGAACTTGAATAATTTTTTCAAAAAAACTTTGGAGATATGATGGAATGCCACAAAGTAATTCTATCATAATATGAAGAATATACTAAAAAATATAACAATAATGTGGTGCTGCTTGATAGTAACTTCTTGAATGTGATAACGCCAATTGTTACCTCTTACTAAAGAATTAGCAATATTATAATAGACATAATGTCGAACTCAATTTTTCAAGCAGATTTAAAAAATAAAATTAGAGACCTTTTGAATAAATACTTGAACAAATTAAAACAAAATTATGTGACAGATAATTTAATTAACATCTAAAGAACATGCCATGTATTGATATTTTATAATAAAATCAAGGAAGAAATAGTCTAGAAATACCATCAAATAGTTAGAAACAGCATGGATTGCAGTATGAGTGCAATCAATCAAGTTATTAAAAATATGTCAGTTCCTTCTGACGAGTTTATGTCCCTCATGAAAGATATGAGATGGGCTAAGGTTTTCTATAAGACAAATGGAAATTTATTAAAATTCATCAACGTAGGAGACTATAACAGCTTGCTTGAAAAAACTTAGGCTTTAGAAGACTTTTTCTTTTAGCTGCAAAATTACATTAAAACATTAGAACAGCAGTACAATTATGCAATCGTAAAATCAGGGAAGTTTCCTTCAGACAAAGATGATGATGATAACGATGATGAATCCGAGGAAGAAAAAAAATAAATCGATCAATAATAAAATTTATAAAAATAGCTAGAAGGAAAATAGCCAAAAAACGAAAAGCTAAAAAATGTAGTTTAAAAGATAATCGAGCAGTTATAAGACAATTATAACTTTCATTTTGATGGAGATGCTTAGAAAATGGCTATGGTTTTGATAAAGTTACTCCAAACAATTTTCTACCCAATATTGCAAGAAAAATGAAATTAGTTAAAAAAATTATAAGGAGAGTATTAAAAAGTTAATAAAAATATAAAAAAGAATGAAATGAAAAAAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1303.2 L-2282.8 L-3292.7 S-0325.0 S-3381.9
S-6330.5 S-9368.6 S-12406.8 S-15335.8 S-24405.5
C-0390.1 C-21,805.5 C-41,569.6 C-61,332.8 C-81,012.0
C-10765.8 C-12958.4 C-14819.1 C-16631.1 C-18455.6