Summary
Transcript IDgene_000004428
Gene IDTTHERM_00125350
Length3970 bp
Sequence
CGGAAATTTAATTTTACAAAATTAATAATTATTCATAGAAATTTAAAAAGATTTGATTGATAAATATCAAATTTAAGATTTTTAGTGTAATTTTGATAGATTTTTAAAGTTGAAGATAGAATTTAAACTCGATTCGGCAGAAAATAATTTTATGAAACCAGAATATATTTAATCTCTAGATAAGTTGAGAGAAGACGTTAACTAATTCTTGAAAACTGGAGAATAAAAGTTGCATTAAAGCATCTTAGAATAACTGGGATTAGAAGGCAATGATATTAGCTACATGGTTGTAGAAAGATTGCTTGATTATCTGGATTTCATAAATGACACAAATACTTAAATATTTTTAGCTAATGGAATAAAGTAGATTGTAAAAATGAATTATAGTATTTTTAGTACTGAGGAGAAAAAGAATATCTATTAAAGGACCTTCAACATTTATAAGAAAATGCCTTAAAACTCATATTTTTTTTAAGACCTTATTATATGTATCTTCAAATTCTTTTATGACAGCATATAAGTTGAAGTATCTTTTATTGAAGATGTTAAATCCTTCAGCGAATAGTCTGCTGAGCATCTTCAACTAGGACTATTATTATTTTCTAATATCATAAATTGCATGCAAGATTATTAAATAAAGTATAAATGTTCATCCGACTTGGCTTACATCGATTATAACTCTGATCTCTCCTAATTTCATCGCAAAAAAGAAATATCTTTCAGATAAAATTTGCTGCCTATTATTTTTGATATCCCTTTTTAACTCTTAAATACAAAGAAAGAAGATCTCATGGTAGAATAAGAGACTAATTTTTAAGTTTTACTTGAAGTACTGAATCTTCTCTACAACTGTCTAAACTATGATTATTTCGACTAAAAAAAAGTATCAGATGAAAAATTCATTGTTGAATCAAGTATATTAAGCATACCTTGTAGAGAGAAAAAATAGGATAATTATATTAATGATTTGAAATCACAGGAATTTACTAGCATACTTTTTGAGTTGTATTATTTCATGGTGAATAAACATAGAGAAATATCTATTAGGTGCCTTCAGATTTTAAGTTTACTTTGTCGTCTTAGCATTAAATTTTTTAAGAAAGAAGATTAAAAATTCTCTTAAATGATATTTATCATTGATGGATTACACAAAATTTATCAGACTCACACATTTATATTTGAGGAGAGTGATGTATTTGAACAAACTTAAGATATTTTTTAAGCATTTTGTTTATGTGTTTCAAAAATACCAATAGGAATTTCTTTTTCTGATGGAGAAAACTTGGTAGGCTTTTGGGAATTTGTTGTAGAAGTTAATAATATTACGAAGGTTGCAATAGATAGAAAAAATATACCTTGCTTAGAGCTACTTCTTGAATTCTGGTGTGGATACTACTATTTTTTATCACATGATGGAGCTTAAAAGTAGGATTAGCTAAGGAGCCTGGTTGAAAAGATTTTAAAAGAATTTATAAAGTCTTAATTAGAAATATCATCTAATTTGAAAGATGACTAAGATTTTGAAGAAGCTATTGAAGAATATTCTGTTTGTATTAAATACTTTGGTTAGTTATCAAATGCATGGATCGATTAAATTGAAGATATATTAATGAAAAAGATATATGCTATATTCTAAAAGAGATCCTAAACTATCAATATAAGCATACGGAATTCTAATAGATCAAACTACTAACAAAGTCTTTTTTATTAACTCTATTGGATGCTTTTACTTCTATTTAAAGCTCAGTCATATAACATAAAAGAAGAGTTACAAACAACAAATAAACACTATGAGCTCGACTCATAGGATGAGATAAAAGAAGATCTAGAAATTCTTCATTAAGCTTTCGATTCTTTTGGAAAGCTTTTCAAAATTGGTTTAAATCTCTTTAAATCGTAGGATACAGAGCCACTTCCTTATTTTTTGCAAAATCTCATCTTAGAAATTGCTCATTTTCTTATAGATTACATATTAGCATTTAAGTCTAACATTAATTTCGATTATCTCAATATCATAATAAAATTTACCGATTCTTTAGAACTAAAAAATTACTTCTTCTTAAATAATATTATAAATTACTTTTTAGACGAGCTATGCTTCTCAGCCAATAACAAGAATTCAGAATAATTTCTTAAGATACTTAAAAGCATTTCCTCTAACCTTTAAGCTACAGATTAAGGTGTTTAAATAGGCTGCTTTCCTTATGACCTTTAAGGATTTTTTGATAGTGAAACTTTTAAAAGACATAAAGAAAACTCTTACAACTACCTTGATGCTAAAAAAGTGTAAAAAATATATGAATACCTATTTGTGATTGTAGATAGACATGAATAATATAAAAAGATAATTATTGAAAATGATTTGCTAAAGTTAACAGAATAGCTAACTCTTTAATAAATAGACTGTAATAAATAATAGAAGGTATCATCAATAAGAAACAGCTTGAAATAGTAAGAAAATGGCTCAAAGTAAAATAGTGTTGTACAAAGTAAAAGAGAAAGTTATGTAAATACCTCACCGTAATACCGTTCATAAATGCAAAACAGTAGGAAAAGTGAAGATTCTTAAAGCAAAAAACTCAATTAAGTAGATGATGATATAGTTGAAATAGTTTCCCCTAATCCTATCTAATAAAATGAAAATACAAATTTAAATATATCTAGAAATTCTTTAGAGAAAAAGAAATCAATTAAGCTTTTATAAGAATCTAATATTATTGATTATTTTAACATTTTTATGAATGTGATCAGTTCCAGAATTTAGTTGGATAATGAAATTCCAATTGGTGAATAAAAAAATATTTTGAAAAGTGTCCTTAATCAGCTAATTGGAATTGTGAAATCATCAACAATTCATACTTACAGCAGAATAGTGCAGTTTATTCTTCAAAATAATATATTTTACTCAATTAAACAAGTTATAAAATAAGAAGGTGAACTTAATCATGAAGAAATTAATTGTTCATTGAAATTTATATCAGAAATTTCATAAACAAGAATTTATCTCATATCTGATCTACAAGAGCTGCTATTAAAAGAAGAAATAGAAATAATTATCGCTACTTAAGATAGATTGCTAAATAAATCTTTTATATAAAATGTTAAAAGTTAAACAGATGAATGGAATTTAGTAATACTGCCTTTAAGCTATTAATATAGAATAATATTTAATTTGCTTTAGCAGTAAATGCTTAATTTTTCATAGCTTGATTCACAAATGATTATAAGTAACATGTTTCATTGTTTAACTGTAATTACTCCAGAAAAAATGAGCTAGTATCATAAAAAACTATATTGGATATATCGTTCTATCCATCTGTTAAGCTAGCTCCACTTTGAAGTTTTCTTATTTCTACAGCCTTTAGAATTTCACTCTGTGACTTAGATTATGGAAGAAGCTTTAAAAGTGAGTTTTGATTCAGAAGAACCAATGGAATTTTTTATAAATGTTCTAAATCAAATTTTTATTTGTAAAAAATCTAACAATTTGATCATGAATCAATATCTTGCATATTCGGAGGAAACTTTGATAAAAGTACTCCAAGCTATTGTTTTAAAAGTAATCAGAAATGAGGATTTAAATTAAAAAAACTTGTATCGTCTTATGCTAGGCTATTTTTGGATGCTTGAGAAAGATAAATTTTTATAAACAGTTAATTAAGTTTTTAGCAGTTTTCCATATCAAAATACTATTTTCATTAACAAATTTGAGAATTATACTGAAGAAATAGAAATACTTGATATTAAAAAGTACTAATATACAGATTAAGCAGTCTTGTTGGATGCTAAAATTATTTTTAAAAGAGTATTTGGTTGATTTCATTTTCTTATTTAGTAAAAAAAATATATTTCAAATTTCCTTTATAAAACAAATTAAATTTCCATTGTCAATGATATCATCAAAAAAACTTCTATATAAATTCAGGACTATAAAATAGAATTTCTATAAAAAAAGGATAATATAAATTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-143.7 L-261.0 L-371.3 S-056.8 S-357.4
S-648.5 S-958.4 S-1268.9 S-1546.2 S-2466.9
C-033.2 C-22,606.7 C-43,285.2 C-63,266.2 C-8699.2
C-10272.6 C-12353.4 C-14299.4 C-16228.7 C-1892.7