Summary
Transcript IDgene_000004431
Gene IDTTHERM_00125280
Length1768 bp
Sequence
CTATTGATTAATGCTTTGATGTTTACTGTGAAATCACTCTAATAATTTTAAGCTAAAAAAGCAATAAATATTTCAATAAAGAAAATGTCTCAGAAAAAGAGTTTAAAATAAAAGAGAAAGTAAGACTATAGCTCTGATACTGAAGAGGAAGAAGAGGATCAATATGAAGTTGAAAAGATCTTAGACTCTAGATTTAATCCTAAGACCAAGCAAAAAGAATATCTTGTCAAATGGGAAAACTGGCCTATTGAAGACTCTACCTGGGAACCTTACGAGCATCTTTCGAATGTCAAAGAAATAGTTTAGGCCTTTGAAAAGAAGCAAAAAGCTAACGTTATGCCTCAACCTACTGGACCTATCACTAGAGTAAATGCCTAGAAAGACCCTTAAAAAAAGAACAGACTATCTTTGAATTCTTCTATCAGCAAATCTTTACCTCAAGAAGAAGAAATTTAGACATCTAAAGAAGACAGTAAAAAATAAGCAGTCAAAAAATTCCAACCAGCTTCAAGAAGAAAATCTATTAGTTCTTAATCTGATTCAGACCTTTAAGCTGAAGAAGTTCCACAGTAGCCTGAAAGTAAAAAAGATAAAAATGATGGTGCCTTTGAAGAACCCAACAATGCTGATGCAGACGAAACTGAGCTTGTATTTGAAGAAATTGTTGACAAAAGAATTCTTGATGGATAAACAGAATATTTAATACGCTTCTAAAATGTCTCTTAGCCATAATGGGTAGATGTTGGACAATTGATAGCTATTAAAGATGATGTTATAGCTTATGAAGATAAAATTGCTGCTTAGAGTTAGCTCAATAAGACTAAGAACTTGAAAGAAAATGCTAAACATTCATCTTAACAATAGCAAAGCGAAAATAATAACTTAGAGACGGAAGAAGTTGAAGAAGATAAAGATTCTAAAAAAAGAAGTTTACTTGCGAATTCAAAGAGACCCACTGCTAAAAGATCATAGCCATTCAATTAAGATGAAGAGAAAGAAAAATCAGTCACTTAGCCTACCTCGAATTTAGGAAGCAAAGGTCAATCTTAGTAAGTTGAAAAAGAACAAGCAACAAACTCACAAACTTAACAGCCTCAAACAGCACACAGAAGTGGCTCAAGACTCAGCTAGATTCAATCAAATGCCAATCAAGTTACTTAATAAGCTTAATAGCTATCAAACACCAACAATTCTTCCTCTACATCTCTTGAAGTTTCATCAAAAATGCCTAGCTAAATGTCTTAAAAACGCAGACCTATTGAACTTACTGAAATTTAACAAGGTGATTTCAAGACCGATAATGTCGATAAGATTGAAATCCAAGGAGATTTTAATGACATAATGACTTCAAGGTTTGAAGTTTTTTGGAAAATCAGATAAGACAATGTTACCCCTGCTTCCTAAGTCTATTCAGCCTCTTACCTGAGAAGATATGAGCCTTAAGTTCTCATCGATTTCCTCTTACAACATTCAAACTAATCTCAATTAAGACAAGCTAATTAATAACTTACTCATTGATAAATTATTTAGTGATTACGGCTTGATTAAGCTCTTAAAACATATGATGAACTCAATAAATTTTCTTATTAGAAACCAAAAAAATACTTGGAAAAAAATTTTTAAAATAAATATATTTCTCATGATAAAAATATATTTTTTTGAAAAATATTGCTGATTATTTATTTATTAATTATTACATTTTACATATTTTGTAACGATTGAGTTTTTAGTTTAAAGAGTTTTAATTTCACATTTTAATTTATGAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-175.5 L-264.1 L-354.4 S-0108.7 S-366.7
S-686.9 S-998.5 S-12104.7 S-15119.0 S-24133.5
C-097.4 C-257,563.8 C-457,835.1 C-664,512.3 C-863,650.6
C-1061,738.0 C-1260,448.3 C-1457,643.8 C-1659,612.1 C-1860,390.3