Summary
Transcript IDgene_000004448
Gene IDTTHERM_00147560
Length868 bp
Sequence
AAAAATTTAAATACATTATTCATTAAAAAAGAAACTAAAAGTAGAAACATAAAATGGACTCAGCTTTTGGTTTAGTAGGAAAAGATTTCGTAATTGTTGCCACTGACTGTTCAGTTGCTTATTCCATCCTTAAGTTGAAGGATAAGGAAGATAAAATCTCATTGTTAGATTAAAATAAAGTTATGGCTTTGAGCGGTGAACAAGCCTATCGTTTGTAATTCTCTGATTATATTGCTAAAAATATTGCTTTAAATAAATATCGTAACGGTACAGAATTTAACACCAAGGAATGTGCTGAGTTTGTTAGATCTGAACTAGCTTATGGTATCAGAAATGGTCCCTTCATGGTTAATTGTCTTATTGCAGGTTTTGATAATAATTAACCTTAATTATATTGGGTTGACTATATGGGAACTCTCGTTAAAAGTGTTAAAGCTGCTCATGGATATGCTGCTCACTTTGTTTTGAGTACACTCGATCATGACTACAAGCCCAATTTGACTTTAGATGAAGGAATAGCTATTATAAAGCGTTGCATCAATGAATTAAAAACAAGATTCTTGATTTCACAAAGCCATTTTATTGCTAAGATAGTCACTCCCGCTGGTATTTAAGTTCTTGAATTGTGAAAGTGAAGGAAAAATAATAAAATAAAACTAATGCTTTAGTGTATAAATTTAAAAGAAAAATTAGGCATGGCAGAGAGTTAGTTATTTATGATAAAAGCGAAAGTAACTAGCTAAACTGCTAAATTTAAAAATAGAAAAAGCAAATTTAATCATTTTTATAACATTTAATATTGTTTTTACATACATATTCAAACATTTTGTATAACACTCACTAATTTTCATGATAAATTTAAAAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-112,540.1 L-211,965.3 L-311,848.0 S-014,328.3 S-36,879.4
S-66,984.6 S-95,482.9 S-126,916.9 S-156,702.1 S-246,246.4
C-02,799.0 C-23,137.7 C-46,130.2 C-64,705.9 C-84,262.6
C-104,757.6 C-124,355.8 C-144,006.7 C-164,666.2 C-184,596.6