Summary
Transcript IDgene_000004484
Gene IDTTHERM_00149110
Length1140 bp
Sequence
AAAATAATTAACAAATAAAACAGAATTACAAAGAAAATTAAATAAATAAAAGGATTATTAAAACAAGCAGTTTTTATAGAAATGGAAAAGGACACTATTGCCACTTATAAAATCGTCTTAGTCGGAGATACAAGCGTTGGTAAAACCCATTTACTGAAGAGATACTCTAAAAACGAATTACCTAAAAACTCTGCTCCAACTATTGGTGTTGAATTTGGCACAAAGGAAGTAACTCTTAAGGATGGTACTAAAGTTAAGGCATAAATTTGGGATACAGCTGGTTAAGAAAGATATAGAGGAATCTTGAGTCTCCATTTCAGAAGAGCTGTTGGAGCTTTACTTGTTTATGATATCACTAAAGAAAAGACCTACAATTCTATAATGAAATGGATGGAAGATTTGAAGTATTTAGCCGATCCAGATATTGTTATTATGCTTGTAGGAAATAAACTTGATTTAGTTACAAAGACCTAAGAAAATCGTAAAGTTTCAATCGCTGAAGCTTAACAATTTGCCCTTGATAATAAACTTATTTTTAAAGAAACATCTGCTGTATTAGGAACTAATATTAAGGAAGTCTTTGAATAACTCCTTTAAGAAATATACAATTAAAAGAAAAAGAATCCTTAACCTTAGATACCTAACAATAATATAAAAGATTTAACAAGTACTTAAAGACAAAATGATGATTGTGCTTGCTGATTTAGGTTATTATAGCTACATGAATAAAAGAAAGAAGTTGATTCTTTTTTCGTTATATTATAATACAAAATAATCTATCAATCTATCTTTAGAATTAGCAACAAATAAAATTATTGCAATTTTAATACTTTCTAAAATACACAATTATATAAATATTAAAATAACTAGTCAATATTAATTGTACTTAAAGCTTATTATGTACTTCTTTCTTTCATTTTTTTAAGCAAGTAAGTAAGTAAGAAAGTAGACAAACGCAAAATTGAAGCCGTTTCTTTTTTGCTAAATAGTAAAACAATATTATTGATCTCTTTTGAATTGCTTATTAAGCAAATAATACCTGAAGTTAACTGTAATTGAATAAGATAGCGTCCGTTTGTATAATTTCTTATATTTTGTATACCTGTATTGTCTAATTTTATAAATAAATAAATACTAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,130.5 L-26,181.8 L-35,637.2 S-03,483.6 S-33,311.6
S-63,165.9 S-93,102.8 S-123,568.6 S-153,580.3 S-243,694.1
C-02,343.2 C-22,948.7 C-45,637.6 C-63,538.5 C-82,135.7
C-102,382.0 C-122,686.9 C-142,844.6 C-162,773.4 C-182,643.9