Summary
Transcript IDgene_000004532
Gene IDTTHERM_00150000
Length4331 bp
Sequence
AATAAATAAAAAAATCAATCAAATAATTGTTCTCAGAATAGTGTTTATTATAAGATGCCTCCTAAAAAGACTAAATCAAGCGAAGTAAAAGAAAGCAGATCTTCTTCTAAGAAAAATGTTATTGATTCTGAAGACAGTGAAGATCAAGCTATTAAGAAAACACCTAATACTAAAAAAGGATCAAATGCTGCAAATGCAAAAAGTGTTTTATCAAAAGAAAGCTCAGTTTAAAAAAGCAACTCATCAGATAATAAAAGAGCTTTAAAAAAAATCTAATTAAGTGAATCTGAGGGAGAAGATAAAGAGCTTTTTCCCACAGCACCTGCGAAAAAGAAATCTGCTCCTGCTCCCAAAGAAATTATAGTTAAGGAAGAAGAAAGTAGCGAAGATGATTAAGTTGTGAAAATTAAAAATAATAAAAATGGATCAGCTGCTGCTGCTACAACAACAAATAAAGTTGCTAAAAATAAAAAGAAAATTAGTGATAATGAATCTTGTGATGAAGAAGAAGAATAAATGACTAAAAATAAAAAAGCAACAAATTAAGCTAAAAATAAAAAAACTGACAAAGAAAATGAAACTAAGTAGACTACCTAACGCTCGTCAAGAAATTAGAAAAAGATTTCTTACAAAGAAGAAGATGAAGAAGACGAATACACTCCTGAATAAGAAGATGAAGATTTTAAGGATGAAGAAGTTGATGAAGTTGAAGAGGATGAAGAAGAAGGAGATGAGCTTAACTCAGATGATGATTTTGAAGAATAAGGCAAAAAGAATAAAAAGAATGGATAAAGAAAAAATAATAAAAAAGCAAATGGAAGAAGTGAAGGCGCAAATAATGAAAAAGCTGCTAAAAAAATTCATAAGGCTCCAGAAAATGCTGATGACAATCACATAATAGATGTATAAAAAGAATAAGGAAAATTGGATATAGAAGATTAATATGAATTGCCATACTTTTTAACAAAGAAGTATTTAAAAGATGCAGAAGGTAGACCAGTAGACGATCCTGAGTACGATCCATCAACTCTGTTTATCCCTATATAAGAGTTAAAAAAGGAAACACCTCTTTTCTAATAATATTGGAAAATTAAAGTAAAGCATTTTGACAAGGTAGTGTTTTTTAGATTTGGAAGAAATTTTGTTTGCTTTTATACTGATGCCATTCTGATGAAAAAGCTCTTCGATTGCTATATTGGAGTCTGGGGCAAAAGACCTGTTGCTAATATTTTCGATAATCACTATCGTTTTTATGTAAAAGAACTTCTCGAAAAAGCAGATAAGTCTTGTTTAGTTGTAGATTAAGTTCAATTTTCAGATGATAGATCAAATGAATAATATCTTATTAAAAGAGAAGTTACCTAGATTATAACTAAGGGTACTTATACTGATTATGTAGATAATGTCGAAGATTATAATGCAAGATATTTAATGTGTATAGTAGAGAGTGAAACTGATCATTCATTTGGTTTAGTTCTTATAGATTGTACAACCCATCAAATATATTTAGATGATATCAAAAATGACCCAGCAGGAAACCAAATTCGTACAATTTTAAGAAAAATGAAACCTGTTGAAATTCACTCAGTCTTTAATAATCTTTCTGAATAAACTAAAAATATTTGCAAAACAACATGCAAACCATAATTTACATTTGATAAATCGTTTGAATTTTATGAGCTTTAAAGTATTTTCGAAGAGCTTAAAAATGAGTTTAGAGAGAAAATTCCAATTAATAATCCCGATAGTATGAAGAAAAGTAATTAAATGGAGATAGAAAAACCCAAGGCCAACAAGAAAAACAATAAAAAAAATAATAAAAAGAAATAAAGTGATGATGATGAAGATGGATCAGATGAAAGCTCTGATGAAGAAAAATCAAAAAGCTTAGTAGATGAAGAAGATGATGACGGAAGTGACAGTGAAGATGATATTGAAAACCTGTACAAGCCTGAAGTTAAAAAAGAGCCTAAATTTACTTACGGTGAACTTAGCAGCGATTATCCTTTACTATTGAAAGATATAGAGGAAATGTACAACATAGATAAAAAAAAATTTGAGGAAGAACTCTAAAAAAAAGCTAATAGGAAGCAAAAAAATTCTCAAGATATGTAAAATGAAGAAGATGATGATGAACCTTGCTTCGACATAGAATACCAGTATTATATGATGCTTTAAGCATTAATGCTTGGACTAAGCTACTTGAGAAAGCTGAAATTGAATGATAATGTATTTAGACTTGGTTCCTTTTCTCTTTTAGATTCAACTGTTTAAAAGAATACTTTTCTCCATTTAGATGCTCATGCAATAGAAAATTTAGATATTTTCGAGGTCAATTTATAAAACCGTGTTACTTCTGAAGGGTCTTTGATGTCTTTTATTGATTACACTAAAACTCAATTCGGAAAAAGAATGCTTAAGAGATGGCTATCTTATCCACTAAAAAGTATATAGCAAATAGAATAAAGGTAAGAAGCCATAGAAGATTTAATGAAAATAGAGGATGTAATTGAGTAATTTGATAAGAAACTCAGTAAATTAGGAGATGTCGAAAGATAAATTAGCAAAATTTTTAACTCATCTTAGAAATCAAGACTTAAACCTACTTCTTTTGAAAACTTCTCAAATGTCAGATTAAAAGATGCTTATTCTTTAGTTGAGGATTTAAAAAATTTAGAAGAAATTTTACTTATTTTCAAAGATTATTAAGACAATTTTAATTCAACTAAACTCAAAAAATTGGTTACTGTAAAGGATCCTGAATAAATTAATAAAATTTTAGAGAGTACCAGATAAAAAAATAACTCGTAAACCTATCTTTCATAAAAATTACTTAATAGGTAAAGCAGCACAAATAGTAAATCTAAGCAGTAAATTATAGTTGGTATTTTCCCAGACTTAAAGCCTTTTGTAGAGTTGATATAGAGTTAGCTCGAATAGGATGAATAAGGTTACTGCCAACCTAAATAAGGAGCAGATGCAGTTTATGATGAAATTGTATTTAAAATGAAAAAAATTTATAAGAAGATGAATAATGAAGCACTTGTCTGGCGTAAAAAATTTAACAATAACTAAGATATAAAATTAATAAAAAGCAAAATGTAATGGGAAATATAAATACCTGAGAAGCTTGTTGAAGGATCAAAGAAACCTAAAGAACTTTATCTCACTTCTAAAGTTAAAGGTTATCAAAGATTCTAAACAGATAAAATAATTAGTCTATGTGCAAAACTTAAAAAAGTAGAAGTCTAATTGCAAAAAGCCCTCTCTCCTTTTTGTGAAAGATTTTTCCATTTGTTTTATTAAAATAGAGAACTATTGTATTAGGCTGTTAATTGCATTGGTGAGTTAGATTGCTTATGCTCTTTGGCTAAGTGTTCTCTTAATCTTAAGATAAGATGCAAACCAACTTTTATTCCAGAAAGTTTAAATAAAAATGTTTTCGAACTTATAGAAATGTATCACCCCTAACTGCTAAAGGAAAATAAAAAAAATTTAGTACCAAATGATACAATTTTCGAAGATAATGTTACTTGTATGCTTGTCACAGGTCCAAATATGGGTGGTAAATCAACACTTCTTAGATAAAATTGCTTAGCTGTTATTCTAGCACAATTAGGTTGCTTCTTGCCTGCTAAAAGTTTTAAAACAATTATAAGAGACAGAATTTTCTGTAGAATAGGTGCTTCTGATAGATTACTAGAAGGAAAATCAACCTTTTTGGTAGAAATGGAAGAGACAGGAGATATAGTGAAAGAGGCAACAAATTAAAGCTTGGTTTTATTAGATGAATTAGGAAGAGGTACAAGCACATTTGATGGTGTATCTATAGCATATGGTGTTTTGAGATATCTTGTTGAGAATGTTAAATGTCTTACCCTGTTTTCAACTCATTATCATATGCTTGTTGATGAATTTAAACTTTACAAAAATGTTCAATCCTATGTCATGGATTTTGATTACTGCTCATAATAAAAGAAAATAGATTTCAAATATAAATATATTAAAGGTTCTTCAGAAAAAAGTTTTGGTGTAAATGTAGCTAAAATGGCAGGACTTCCTGACAGTGTAATAGATAAAGCTCATAAAATGGAACATTATATGAATTCAGAAGATTAAAATATAGGTAATGTTCGTAGAATTACTTAAAAGTTTAATTCTATTATAGAAGCTTAGCATTAAAGTGACGATACACTTTTATAATTACTTAAAAATAGTTTTTGAGAGTATTGAAAATTTAATTTTTAAAAACAAACATGTAATTTTATATAAATTTATAAAAGTAAAAAATTTGTATTTACTGACTAATTAATTAATAAACAAACAATAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,217.3 L-21,261.6 L-31,110.9 S-0620.5 S-32,935.1
S-61,894.6 S-91,541.9 S-121,284.2 S-151,233.8 S-241,761.5
C-01,633.0 C-217,709.5 C-45,312.0 C-62,387.9 C-8950.4
C-102,123.9 C-123,973.4 C-142,543.2 C-162,448.1 C-182,542.9