Summary
Transcript IDgene_000004632
Gene IDTTHERM_00218520
Length3493 bp
Sequence
TTATCTTGAAATTTAAAATTCTAGTGATATTTACTTTAATTCTATTTCATCCATTTCTAATTACTATAACTTGAATTTAAAATAAATCAACTCTCTAAACAATATATTCACATTACAATCAACTTTGATACAAATGGAATATATCGAAATGAATAACATTTTATCTTAGAACAATTCTTTTGTATTTAGTATAACAAACTTTTAAGATTGTTTTATACAAAATCTAAGCTCACTTAATTGCTCAACTTCAATCATTTTTCTTGGCTAATAAAAAAGTGGAGGATAAGTAGTAATATCATAATCAAGTTTAAAAGATAATTCTATTGATGGGTTTCATGGTGACAATTCATTAATAAATTTATAAGATATCCTCTATTTTACATTAAAATAAACAAAAATACTTAAAAATAAAGTTATAAATAATTAGCTTTCTTCGATTTTGAAGATAAGTTAAACTAATAATGTAAACATAACTGATTGTAAATTTACTAATAATTTTAATTAAAATGGTCAAGGAGGGTCAGTGCTAGTTTCTAATGCAAATCAAATTTACATATAGGACTCTAGCTTTCAAAATAATATATGCAAATAGAAAAATGGTGGTGCCATATATTTTATGAATACAGTCAATGTTGGAAAGCTAGAAATTTCTAATACCAATTTTATATTTAATCAAGCAGCCCTCTCTACAGGTGGAGCAATAAGTCTTGATTTTGTTAATCTTATAATGCATCAAACTTAATTGTACTCAAATAAAGCTTTAATAGGAGGAGCAATTTATTATTCTTAAGTTATACCTGATTTTGTTTTAGAATATTAGTAAGGAATCAATAACTCTAATCAAATTAAAAATAATTATGCCAAATTATATGGTATGAATATAGGTTCCGTTTTAAGATAAATCAAAATAGATGCATCAAATATTTCTTTGAATAGAGGTAAAGTTTCATATAATGGATAAACAGTTTCTATAAATAATGCAAAAAGTGGTGAAGAAATTATTTTTTCAAAAATATAACTTCTTGATGAAGAGAATCATCCAATATATGTACCTATACCTACAGAGCAAATTGATTATAGTAGCGATGTATAGTTAATACTTAGGTAGCTTAGTGTTTCTATTGAGTGTGAATAGAATAAATAAATACAATGCTCAGGATAGTTACAATCAAAGCAATACATAAATGGTGGTTATAATCTAAGAGTTTAGCCTATGTATATGCCTTTTAAAAATATGGCTTTGCAGATAATGTCAAATAATTAAAATTAATTAATTGATTCAAAAGGAAATATAATTATTAGTGATAATTAACTATAATTAGAAGTAAATATATAACTAGGTTAGTGCTCAGTAGGAGAAGTTTATAAGTAATTTAGTGAATCAATAATATGCGATATGTGCCCAGAAGGTAAATACTCTTTGGATTTATCTGAGAATTCTTGCAAGACTTGTCCTGATTCTGCAATCAAATGTATTGGGTCAAATATTTATTTAAAAAATGGATATTGGAGATAAAGCAACTTAACTGATGAAATTATATAATGCAGTTTTAATTCTTATTCATGTCAACCTCAAGACCCTCATTCTAAGTTTCTATGTGCTGAAGGATACATAGGTCCTTTGTGTTATTAATGTGATACATATGGAGAAATATGGGGTAAAAGATATGCTGTCTTATATAGTGTAGGAAATTGTTACAAATGTGAATAGAGTACAAAATAAATAATAATCAATAACCTCATAATCTTTTTATTTATTTTTTTCTACTTATTTTTCATCATCAAGAATATTTTAAAACAATTTTACATTAAGCTTGTTGGTCACTACTTAACTAGGTGTAATATACTCTTTTTAGGGACAACTTGTTTATCTGACAGATAAGAGGTCTTTTCAAAGATTATGACAGACCATATTTAAGTTATTTGTTTGGTAGTAACTTTTCAGACAACTTTTCCTTTTCCTTTTTCGTTCCAATTTCCTTTTTAAGTAACTGGAAACTCTATGAGCGTTGTAAGTAAATCAATAGACTGCCTATTTTCACAATATCCTAATTTAAAACCTCTTTGGTTTTATCAAATTTTATGGTCATTTATATTACCTTTCAATATCATCTTTTTCCTTTTTTTTTTCGGTATCTTAACCAAAAATTAAAATTAATTCTTAAAGTACAAAAAAACTGTTATTATTTTTATATACTTATATTTTTTCCCTATGGCTATTACTTTACTAACTAGGTCTTTAAACTGCTTAGATGTAGGGTAAAAAAGTTATTTTGATTTAGATTTTACTATTTAGTGCTTTGATGAAAATTTGCATAAGCCTTACGTGCTATACTTTAGTCTACCTGCGCTAATAATATGGGTGATAATTATTCCAGTGATCCTTTACATAAAAATATTAAGAGAAAAAAATTCTAAAAGATCTATTTTATTCTAGATAGAATACTCTTTTATATCTGTCGGGTATAAAGAGAAATATTATTATTGGGAGTTCTTAAAACTACTTTACAAAGCTTTATTGATTTTATTATCTATTTTGTTAAAGCAAAATGTCTAATTAAAAGTGTGCATGATGAATTTAGTAATTTTGATCAACTTTTATGTAGTATTCAAAGTAAAGCCCTTCAAAAAATAGTATTTTAACAACTTGGTATAATAGTCTACTCTTATTAGTGCTCTCTCTTTATATTTTTCATCATTATCTCCTGATGTTTTGTATGAAAATGTAGTCTTGCAAGCTTTATTTGTGATTTTTGTAGCTACTTTAAATATTTTGTTTATTATTAAATTGGTGTGTGGATTAATTAGATTAAATATTCCAGCAGAAAAATTAGATAGAAATTGCTTATAAGAGATGTTTTATACTCTAAAACTAAAATATCCTTTACTTCTAGAAAACATAAAGATTGATAGTAAACAGAGAATTAGAGCTTTGATTAAGTTAAAATCTGTTTAGAAGAAATTTAGGTAGTTTTTAAAGTACTTAAAGAATAATAACTTGTACGAGTAAGAAAATTTCAAGTCATTATTTTGCTCTTAATAGCAGTCACCTTAAAATAAATAATTATTTGCTTTATAATCTCCAACTTTATAATCTCCAACTTTAAGCAATTAAATATTTACTACTTCCAATTAAAGTATTGACACTGAATTGAGAGGTCTGAATACTAAATTAGATAATTCAAGCAAAAATTTAAGAAGCAAATGGGCAAAATATTCTAAATTATCAAAGCAAAGTTCGTTAAAAAGCCGAGGTGAGAATTTCTAGCTAGCATTAGTCAATACAAAAGTTCATAAAAAATTTAGTAGATAAGCAACAGCTAGTGATAATGAAAGCTAGTCTATATTTGCACATGTGTTTGATAATTAATCTTCATAAATGTAAGAGAGTTTAGTTTAAAACATTAATTTTACTAATGTTGTAGAACAAGTATAAAAATAAAATGAAGTTGAATCAAATAATGATAACAATCATGAATTACACAATATTGAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1150.4 L-2126.0 L-3117.7 S-0233.7 S-3214.1
S-6230.8 S-9171.3 S-12134.4 S-15225.0 S-24257.9
C-0505.9 C-22,396.2 C-41,566.5 C-61,316.9 C-8874.7
C-10515.9 C-12497.1 C-14365.4 C-16422.2 C-18437.6