Summary
Transcript IDgene_000004811
Gene IDTTHERM_00145390
Length1469 bp
Sequence
GAAAGATTGTTATTAGAATTAAACTAAATATGAGCTAGCTTACAATGGAACAATTATAACAAGCGTATGGTGGATTAACTTTAAACACCATGGATCACAAAATATATCCAGATTAGAAAGAGTTATCTAGAGGTCCAGGAACCGCTTGCTTTCTTAGATATAATAAAGAAAATCCTAATATCAAACCATTCGTTTATAAATACGCAGATTTTAAATCTGAAGAAGAAGGAGCCAGAATTAGATAAGAAGCAAATTATGGAATTCCCTTAATTAATAGAGAAAAGTATACTTAAAAGGTTATTGATTACGTCATTGGTAAAAACACTTTTCAAGGCTTTTATGAATACATAGAAGGAGAAAGTTTGTTTGACTACAGAGAAAGAAGAAAAGCTGAGTCAAATCCGATATTATATTAAGAAGCCGCAGCACTAACATTAGAAATATGGAAAATATTAGAGCCTTTGCATGCAAGAAATGTTAGTCATAAGAACATTAAACCTACAAATATTATTAGGAAAAAGTCGAATGGCAGGTTATACTTAGGGGATTTTAGCTTTGGTAACATCCTTTATGGTAAAATGCATTTTGGTATAAAATTTAATGAGTAAATGGCTTTGTACAATTTATGCTTTGATGCAGATGGTATGAATGAATCTACAATTGGTCTTAGACTAGATGGATATAGTTTAGTTATGCTTTTCTGTTCACTTTTAGGTAAAAAACTCTGCTTAGGATAGTTTAACAAAGGAAATCCAACAAATTTTATCAACATGTCAGGCCTTAATCCTCCAGTTCCTGATGTGGTAATAGATAACATCAAGTTTTTATCAATAGGAGATGCATTTGGAAACAGATAACCTTTAACAGAAGTTATTAGAATATTGAGCATGTGGTCTAACTCTGAAGCATAAATATTCAAATAAATATAGTATTAAGTATCAGATGAAATTAAAGCAATAGCAAATTTAGAAATAATGCCTGATAAAGTAATTATGATCCATCCGTGTTCAAATATTTCTGATGAGCAATTCTTTAGTTATATGACTTGCTTATATAACAAATAGAGATAACCTTACAAAAAAATTAATATACACTTTGGAGGGAATATGATAACTCAGCACTCATTTTTTAGAATGGTTGATGCGTTAGAAAATTTAAATACTTCAAATTTGAAAAATTTATCTATCTAAATGAATTACAATAATTTACAAAATATTTACAATTTTGTAATTAAGTTCAAGCAGCTTAAACTTCCTTGTCTTGAGAAGCTATCAATAGGATTCAACTCCTGTTAAATTTATTCAGAAAATATTTTGTTCTTCATTGATTCAGTGTTAAATTAAGACTTTTAAAATCTCAAAAAACTATTCCTTGATTTCAGAGGAAATTGCAACACTTCAGAAAATGAATAAATACTCGACACTTTTTCTAAGCTAAGACAGAAGTATAAGTAAAAGATAAACTCAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1982.1 L-21,006.5 L-31,215.5 S-0400.0 S-31,704.8
S-61,997.4 S-91,598.3 S-121,060.1 S-15910.0 S-24811.5
C-01,389.4 C-2805.4 C-4595.1 C-6669.7 C-8720.1
C-10900.7 C-121,048.7 C-14815.9 C-161,272.9 C-182,029.9