Summary
Transcript IDgene_000004830
Gene IDTTHERM_00145630
Length1054 bp
Sequence
AAAATATTTCAAGAGAGAATGAACTAATTAGCTAAATTTTTCTTTAAGAGTGCAATTAAAAGTAGTAGATAACCTTTCTAATTGACCCAAAAATCTATTAGAAACTTTTCTTCTATGGAATAATTGAAAAAGTTAAGAGATGAAACTGGTTCACCAATTGCTTAAGTTAAGAAAGCTCTTGACGAATTTGGTGGAGATTTTGAAAAAGCTAAGTAATTCTTGATTGAAAAAGGTTTGGCTTCAGCTCAAAAGAAATTAGATAAAGAAACTAGAGAAGGTGTTATTGGATTATATGTTTCTTAGAACAGAGACCTTGCAGTTATTGGTGAAGTTAACTGTGAAACTGACTTCGTTGCAAGAAGTGATTTATTCCTTGATTTCGTTCATTCTACTTTAAAAACTATTGTTGACTAAAAGAAGAACGTGAAGTTCAATGATGAATAAAAGGATCAAATTCTTTAATTCTTATAAAATAACACTCTTAACAAGGAGATCATTGAAGGAACAAAAAATGAAAATATGGATAAAGTTAGATAGTTAGTTATTTCTAAATTATAAGAAAATATCAACGTTAGAAGAGTTAGTACTGTAGAAATTTAAAATGGTGTTATTGGTTCTTATACTCACAACACATTAGCTGATAACATTGGAGCTAGAGCTTGCTTAGTCTCTTTAGAGGGAGCTAACTCCTCTGATGTTTCTAAATAATTAGCAGACAATATTGCTCTCTAAATTTTAGGTATGAAGCCAGATTACATTACTAAAGAAAATATCCCTGCTGATGTTCTCCAAAAAGAAATAGATAGAATTAAAGCTGAATTCGGAGATAGCTTAAAGGGTAAACCTTAAGCTGTTGTAGATAGAATGATTGAAGGAAAGCTTAAAAAATTCTATGAAGATAATGTCCTTTACGACCAAACATTACTTACTGACCAAGAAAAAGATGCAAAAACTATCGGCTAATTAATTAATGAATAATGCAAGCAACAAAACTCCTAAATTAAAATAAAAGAATACATCCTTTGGACTTGCAAATGAATAGAAAAATACAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,391.9 L-24,724.9 L-34,614.9 S-0430.4 S-344.0
S-634.5 S-941.3 S-1253.4 S-1551.7 S-2453.9
C-040.6 C-2630.7 C-4137.2 C-666.7 C-883.2
C-10515.1 C-12426.5 C-14170.9 C-1666.7 C-1862.0