Summary
Transcript IDgene_000004899
Gene IDTTHERM_00353270
Length6127 bp
Sequence
TTAAGTTTAAATATTGCTGAACTTTAGAGAAACGAATTAAAGACAGCAATCTTTAAATAATAGGTTTATATTGGATTGAAGGAATATCACTGAAAACATTATTAGAATAGAATATTAAAAATCTTTGAAATGAGTGAAGAAGATCTATAATGTTGTGTCTGTAAATGTGGAGGAGATGAAATAGAATATTTAATAAGTTGCAGAGCATGCGAAGGAGAAAAAATCAAACAATTTTGTAAATAATGTTGCAGAAAACACTTGAAAGAAAGCCCAGATCATTCATCAGGGATGGCAATTTTTTGTCAAGAATGCGAGGAAGTCGAAATAGAAGCAACTTTTTACTGTGGGAGCTGTGGATAAAATCTATGCACAAAATGCGACTAAAGAATTCACAATAAATGTAAAAGAGCTAAGCATACTCGACAATAGCTGAATCTTCAAAGAGATCTTTTAATTGAAATAATTATTATCATTGATGAGAATTTAGCAGAAGTAATTAATAGTAAAAAAGTGGTTTATGATGGATTTATAGATAAATTACAGAAAAAGAGAATAAAATGCGATAGAAGCTCTTTGGTTGTAGTTTTTAGAAATACTTGTGAAGAAATTTTAAACTTTGATTTGAATTATTAATGGGAATAATTTGAGCGCTCGAACGGGCTATCTGAAAAGTTTCTTAATACGCTTAAATTCATGCCTCAGTTAGCAACATGCGTTTTCTTTCAAACTTAATAAGAAAGCTATGCTGCTGAGAAATCTTCTCTCTCATAATTGTTTCCTAACGTTCAAGTTATATTTACAAAGCTACCGATTTCCTCACCTGCAGTGTCAACTGATTAGTAAATAATATTATAACAAAAATAGTAGCAAATCTAGCATCTTCACTAAGTTTAATAGCAAATATAGCACATTTTTCCAATAAATCAAATTTAAATGAAATAAAGTTCTATCAATTCAAAGGCACAGTAATAATAAATTTAGCAAGCTACATGGAGTAACTAGAATTAGCAAGATCAATAACAGTAATTAGTTTAAATTCAATAGCAGCCATAAAGCATTCTTGCTCCATAGTAAAATACATAATTTATTGGAAACAATTCCTTCACTTAATAGCAAGCTCAATGTAATCAGCCTATTTAATATTGTTCAACAGCAGATAAAAACAACACAAATTTAAATTCAAACGGAAACATATAAATCTAAGTAAAAGCAAACATCGAGGAATCTAAAAATTCTTAAAATAACAGTGCAGTCTATAATCAAATAGAAGATGAATAAGCACAAAAAGTGGATTCTAAAAGTGTTAATGGATCTTAAATTTGCAAAAAGAAATATGGAAATAAAAGTTTAAATACAATTTTGAATCCTTGTAACTCATAAAATATAGATAAAAAAAACTCATAATATCAACATAAAAATTAGTCGTTTGACGATGGATTCTAAATTTATAGCTCTTCCGAGTCTCACTCAAACGAGGGCAATCCACCTTCTAATTTAAACAGTAAATTCCTGTTAATAAATAATAGCAACATGAACAATAGCTAAAATAACAGCAATTTAAGCAACAACAACATATTTAATAATAACAATAATATTATAACTGGAAAAGCATGCAATTCGAATAGCTTATATAATTAAATTCAGTAAGGAAGTTTAAGCAACAGTGTTTAACAAATAAACTAGTAAAATATAATAGGAGATAATAGCGGTATTGGCAATAACAGTCTTCTCAGAAATAACTAATAAAATAGCAATTTAAACATTTAGAATACGATAGGAAATACTAATAATAGCAATACTTTGAATATAAACAATAACACAAACAGCCCAAATTCTAATATCATGACTAAATAGGCGTCTTAAAGACCAAGAAATAACTCTTCAAACCATAAACATAGTCAGTAAACAAATAGTAACAATGTAACGAACCCCTAGCTAGATTATGGCAATATAAATAGCAGTATTAACAATACAAACAATAGCTTAAATTAATTTCATCATAACAACTCAAACAATAACAATATTTTAACCAATTAAATTACTAATATAACAAATCAAGTACTTTCTAAAAATACAGAAAACACAAGCAGAAGTAGTATACATAGCACAAAATAACCTTAAACTAATACAAGTGCTAATAATAATAAGAATAGCAGTAGTGGAGCTGGAACTTAATAAAAGTAAAAAAAATCCAAAAAAGCAAGCAAAGGCAGTAGTAATACCAGCTGTAACCGCTTATCACGAAACACAAGTAGTGGAAGTATTAGAAATTTAAACACAAGTAAAGGAAGTATTGATGGAGGTACTAATAACATATTAAATAACAGCTTAAACTAGGGTCTAAACAAAAATGCTTCATCAGGAGCTTTGGAGGTAAAGTCAAAGAATAGCCATAACACTTACACTTGTGGGATGCCATTCCAGCAATTTTAAAACCCAAAAACTGTGTCAGTTAAAAACTAGCAAATAGCAATTGGCATATAAAAGCAGCTATCTTTCTTAGCTGAGAAAGGAGAATTAATGATACACAAAGAAGTATTCTTGAAGATGGTTTAAAACAATATTCCTGGTTGCACTGAAAAAGACTGTGTTGAAATTTTCAATGAAGCAGAAAATGCTGGAATCATACATCAGACCACAAGAACATTTGCTAATTCCACCGAATTGCATTTTGTTAGTTTAAAGCTAGAATATATTTCATTATAAAGTCTAATTTGGATTATAAAATCAATTAAGTAAGACCTCATGACTCCTACTGATAAACTCATTTTAAGTCGTATAAAAGAATGTTTTGGATTAAAGCTAACTCCAAAAAGTTGGGATATGATTTTAAATCACTTGTAGCACCCAAGTTACATTCAAAATTATTAAAATGGATAAAATGGATTAGATCTCCCTTAATTAGTAGTACAAAAAGTAAACGATCCGTTGATGGGAGCAGATACTACTGTAATTTATATTAAAGAGTAAGAATGGATTCCAGAAGACAAGGGAAGGATAGATTTTGATAACGATAAAATGTGGAAACTTTTTAAAGAATTTCTAGACTAATACTTTAAACAACCTATATAAAACGAAGGAAGCGATGATAATAAATCAAATTCTTCTGCCTCAAGCAAAAAGAATTCTTATTTTACTACAAAAATCACAAAATCAAGTAAAAAGTAATAGGCCAATAACCAAAGTAGTTCAGCTAATCAATAAAGTTAGCTCAACTCTCAGGTGAATTCTGCTAACATTGCAAATGTCAATAATGCTTCAATTAACACGCAATCTTAATAAGAGTTAAGAGCAATTCCAGGTGGAAGATATGGATGTGTATAATATGTAAAGTATTGTGGACCAAGAGAACTGTAGGAGCTTTCGTTGGGTAGATTGAGTTTGTTTGTTTAGGAAGCTATCAATACAGGAATCATTAGATATCATAGAACTTTATTAGTTAAACATACATACAATGAAGAAAATAGTGTTTTGAATGAATCCAGCTCTGTGTTTTCATTAGAAAATTCTGTGCATATTTTAGAAAAATCTGCTTATGGACTTTAAAGAGATGTTACTGTTAAACACTTACAAGATGCCTTATTAGAAATTCTTTAAGAATATCCAAAAGGTGTATCTCTAGTGTAAATACCATAGTATCTTAAGAAAAAAGTATACTTCTAATTTAATCTGCAAGATCTAGGTTTTCCAAAATTAAAAAATTTTATTCAGACTATGAATGATAAGGTTCAAATAGAATTAGCTGGTACAAACAATTCATATGCTATTTTAAAATGTAATGCTTCTAAAAGCAAATGTGCTCCTTCTTTTTTACCAGAAAATAATATATCAGATTAATCTTGTACATCTTCTCCTTTATCAACAAATAATCAAGGAAACTTAGTTTAATAAAATGATTAAAGTGGAGCATCAAACTAAATAAATAGACAAGTATTTGGATTTAGCTAAGGCTATGGTGGAATAGGGTAAAATAATCAGTAATCATATGTAAATCAATAAAGCCAATAATATTGCCAAGACTTTTAAAATGCAATTCTTTAGACTCAGTGTGGTTCTAACAGTGAGTAAAACTAAAAATAAGCTGCTATTGTATTAGAGAAGCTTAACGAGCTTTTAGAAAAGGTAAAATAAAATATAGAAGCTATCCTTAAACAGAATCCAAATGGAATACATATTAAGGATCTTTACAGTGCATTAAGTAAATCAATGGGAGTAAATTTCTAGTTTGGGCTTTTTGGATCAATGGACTTTTTAGGATTTTTAACTTCTTATGCTGAATCAATTATTGATATAGAGTGTAAGTAAAATTACTATGTAATTTACCAAAAAAATCATAGATTTGGAACGGAAGGAAAAATAAATGGAAGTACTGGAAATCCAGCGAACACAACAAATAATAGTAAATTAAACTACAATACTAACTTTTAGGCACATATGATTTAAATGAATAGCTTGACTGGAAATGCTCAGCAATTTTAGCATCCTCCATTTTTCTAAGAGTTTTCTTAAAATCCAAATCTAATCAATTTTTAAAATAATTACATGAACTTAGCATCTTAAAATATGATGAATTTTTTGTAGCAGAATAAATAAGGAGGAAATAACTAAGTTTAGTAATTGACTTAACAGTAGCAATAGTAAAAGCAATCTGCTTAAACTCAGCAGAGCACAGGAACAAGCAACGCCAAAAAAAGAAGCATGGCTATTTCTCAGAGTGCTTCTAATATATTCAATAATGGAAGTTCTTCGTAAAACAGTAATAATAACCCAAATAATAGCACAAGTTCTACAAATTTTATTTAACCTCCAACACAGTTTAATAGTATGCAAGTTGGTCCTTAATAGTCTCCTTAATAACAATTCTTCATTAACTAATAACAGCAATTTTTACAAAACCCTAGCATTCTACAATAACAGTATATTTAAACATAACTAGCTTAGCAATATTAGCTTTTTGGATATGCACCTTATCCCAATAATCCTCAGATATCTCCAAATATGCAAACAAATCCATTTGGATAATCTGAAACTCCTTAGCACGTAAGAAGTCTTTCTTAGCACAGTAATAACAAAAACACTAATAGCAATCCAAATTTAACTATAGGTAGCGCAGTTAGATAAAATAATACAAGCATGACAACAAACTAACCAACTAACAACAATAACTATATAAATAATAATTAAAACCACATTTTTCATTATCACCCTCATCATCCACAATACTTATAACAGCATGGAACACAATTTAATAGCAATAACGGGTATTTTACACCATTCTATTAAGTGGATGTGTCATAATATTAATCTACTCACAGTAGAAACCCTTCAAAGAGTAGGTAAAAAGGGGAATAATCATCAATGGACATAAAGGAAAATATAGGATTATTGGAAGATATTTTATAAGATACAGAAGAAAATTATTCATTTAGAACTTAGACAGATAGAACTTTCATGGGTGATGATAATCTGACAAGCTTTAATTGGAGTATAAGCATTTTAAATCCTCATTATTAAAGTGACAGGCAAAGAGAAATTTCAACAGAATTTGAACAGTTCCCATGTGATCTAAGCAAAATCACAAACAAAGGTGGAGGTAGTGGGAGTGGTGGTTATTAAAATCTTGTAAGCTCTGCAATGAATGAAAGAATAACCACTTCAGGAGGAAATAACAATGGAATTAAAAATAATGGTATAAATCTTCTTCCTAATTATTAACAACAAGGTGGGTTACCTAGTTATTAAAATGTGTTAAGCTCAACACCCAATTCTTAGTAATAGTAATAATAGTAGTATATGAACTATTTTGTTAATCCTTAAATATATTCCTCTTCAAATAGCTACTTAAATTAAAATGTTTAATAATTCAATACTAATAACTCATTTACAAAAGAAAATAACTCAGAAAGAAAAATTTGATTGAATATTTATTTTCCAAATAAAAACAAACTATTTTATCAACCAAAAAATATGAAAAGAAGCTATTTAAATACAATAAAATTTTGAGAGTAATGTAAAACATATATTTATATTTTATTAAAACAATTTTGCTAAAAGTTTAAGAGTGAGTTTTCCTTTTAAAAAAATAAACCATATCAAAATTATTCAACTAAAAAATATTCATTCCCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1627.5 L-2624.2 L-3714.5 S-0704.1 S-3721.6
S-6491.3 S-9642.6 S-12588.3 S-15882.2 S-241,210.2
C-01,205.1 C-21,467.2 C-42,026.5 C-62,205.8 C-82,312.9
C-101,451.9 C-121,567.0 C-14840.3 C-161,082.4 C-181,922.3