Summary
Transcript IDgene_000004945
Gene IDTTHERM_00348250
Length2592 bp
Sequence
CGTTATCATGATATCATTAATTAAAAGAGTTCAAATAAGATAAAAAAATATGAGCAATAAGATGATAGTAGTAGAAATTCTTATTAATTTTAGAAATAAAGGGAATAGAATGATTTATAAAACTCAAGTGATACCAAACTCAAAGAGAATATTCAACAGAAAGACTATCAAGAGGATAATTACGAAAATGAAGATGATTATCATTCGAAGGGTCATAGAGTGATTAATACAATAGACAATATCTTTAACAAAATGAAAACAAAATATAAAATGGATTTTTCTTTGAAGGAAATCCAAAAACATTTAAATATTCCTGACTCAACTGCAGGTAACTCTGCTAATTCAAGCAGATAAAATTTTGAATCAAATTCTTAAGGTGATATTACACTAAGCTAACTAAACTAAAACCAGAGATTACTACAAATATAAGATTTTTCTGGCTTTGACTATGAAACTAATCCAGATTCAATAGTTCAAAAAATAAAAAACAAAGTGCTAAGCAGATAAGGAAATTAATTTGATATATAGTAAGAATAGGTAAAATATAATAGTAATCAGGCATAGACAACTCAAGAATTTAAAGAAAAGCTAATTGAGAATAAAAAAAATGAAATAAAAAAACGTCTTTCACCTTCAAGAGTTTAAAACAAAAATTCTATAAATTAAATAGATGAGCATGATGCTGATATGGAAATAGAAAGAATAAAAACTAGAATTTTTAACAGAAATTCAGAAACTAAAAAGACAGAAGAATCACCTTAAAAAATTGAATAAGTTCCAAATAAAATAGATAACCAAAAAATTTAAGAAATTGATTCTAAAGCAACCAAAAAAATTAATAAGAAACATCCAATTTACAATTCAAGTGATAGCAGTGAAGAAGATGCGAAGAATCCTAAAAATTCAATAAATTCATAATAAAAAACCAGCAAGAAAATAAATAATTAAGATTATTTTAAAAATAAAAATGACAAACTCATCTATGATGAAGAGGTAGAAAATAAAAAAAACTAAAAAAATGTTATCCCAACAAAAGAAAATAATATGAAAAATGAATAAGTTAAAAATAAAAAAATGGAAAAACATGAAGACGAAAGCTTAAAGGCATTAGAATAAATTTCATAAAATAAAATTAATTTTAAAGAAAACATAAAAAAACTAAAACAAATATTTAAAAATAACTTTGATCTATAAAAGTGCAAGGATGATGATGAAGAAGAAGCTTAACATTAAATTGATAAATAAAATTAGAATTTTAAAAATTATAACTAAATTCAATAGTACTAATAGGGAAGAGATAGTGAATTAGAGTACTCACAAGATCATTAAAATTTCTTTTATGATGAAGATACAGTGACTACCAAAGAACATATTGTGATAAATGATTAATCTGAGAATTTTATTGGCAAAAGAAAACCATAAAGTTATAACCAATAATTTGGAGTTGATAATGATGAAATTGCTGATATGGATAGCGAAGTATTTAATATATCTCCAGATCACCATCCGCAAAATGACCATCATTTAAATAGTATTCCAGATGAAAATCATACTATCAGTATATTTAATGAAAACTAGTCTCTTTAAGCTAGTTTTCTTGAACAAAGCATATTTTAGAAGAGCCCCAGATAATCACAAGCGGCACATTATAATAATAATAACACATTTTCACAACAAATAAATAAAAGAGCCAATTAAGGTAGTTCCCCTTCACCTATACTAAATACTTAGATTTAAGGCCAGATTTTATAAGACAGTTTTCAGAAAAATCCACAAAACTATCGCTAAAATAATTAAAAAACTATAAATTAACCACATACCTAAAATATTTAAAGCTAATCTGAAACATCTTTATCATAAAATAAAATAAACTAAGGATAAATAAATAATTCAGTAATTAACAAAACTTAGAATTATGTACAATCAGATTTATAATCTAGCTATCAACATAATAATGCTTCAAATCTCAGTTATAGTCAATCCATGCATGAACAGTCTTAAATATATTAGAACGAGCAAAAAAAATATCAAAACGATTAGTAATACTAGAATTATACTTTAGGTGAGAGAATATTACCATTAATAGAAGAGGAGGATGAAAGACTATAAAAAATATATGAAACTGATCCAATCTTGCAAAAACTGCACCAAGAAAAAAGTGGTCTAGAATTTGAATTAAGCAAATGGGAAAATATATTGCAAGAACTTAATAGATAATCTAACCATCTTTAATGAGTATACAAATTTAATTATTCTATGCTTACTTTGAAAGCTAGTAATCAGGCTGTGCTTTTTAAGATATTAAAAGAGCTGAGAGAGATATATGTTTCAACAACTTTATCAATCCAAAATTACTTGTAAGTGGATTAAAATTATTTTTAGGAGTGTTATATTGTAGATAGATAGATAGTTAGTTAGTTAAAAAAAAATTAATCAATCAAGCAAGCGAGCAAGTAAGAAAGAAGAAAGACTTATTATAATTAATTATAGTGTTTATTATCATTTAATATAATTTAAAAATCAATATTTATTATGATTCCATTTATTTATATCCTTAATTTATCATTCTTATATTTATAATTTCAATTCATG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1395.8 L-2352.3 L-3352.5 S-0466.1 S-3572.4
S-6375.0 S-9392.1 S-12399.1 S-15399.2 S-24458.3
C-0463.7 C-21,175.2 C-4545.2 C-6593.9 C-81,182.7
C-101,221.5 C-12974.4 C-14565.8 C-16493.5 C-18455.8