Summary
Transcript IDgene_000004948
Gene IDTTHERM_00348200
Length1329 bp
Sequence
ATTAATTTATTTTAATTAAATAGTTTATTTATTATTAGCTATAATATGAAATCAAAGTTTTTAGACACTCTTTTTGATAATATTCTAAATTGGTTAGGACCTAAAAAAAGAAAGCGGTAAGCAAAAAGCTTTAAAATTCATAAAAATAAAGGATGATACTATAGGCATTAAAGTAAAATAATGAAGAGTATTCATTCCTTCATTTCAACTAGACGATATTTCTATTGGCGAATATGACGGAGAGTATCCAAGGATTCCTGATCCTTCCAAAAAAGTATTTAAGTCAAGCGATCAATTTAGTTCTTCCAACGATTAGAAACTAGCCAATAATAATAATAACAGCAGTAGTGCAAATTAGTCGAGCGATGATGTGCCTTAAATCATCCATTCAGTTATTCCTATAAAAAATAATACATCACCTAGAAAGGAAGCATAGTATTAACAGATTAATAAGAAAGACATAATAGACCATAATAAAGAAAACTCGAATACGAAAGTAAAGTTGCAAAACTAACCTAACCCTAAAGTAATTGTGCTCAATGAATGCAATGGGAATTCAAAAAAAAACGAATTTTAGCTAAATGGAAAGAAGGAAGCATAACTCTAGGAGTTTATTGTGATAGAAGAGGATGGAATTGAGTAGGCAAAGTAAAATCATAATTAAGATAAATAATTGTAGCTAGCTAGAAGACCGTCTTCAGCGCAGTATTAAATTGAATAAGATAGAAAGTAAAGAGAGAATTTAGATTTGGAAATAATCCAACTCCCAAAAGAATTTATGGAATTCAAAGAAATAACCGATGAATGGATTTCGAATGACTTTGGTTTGCTCGAATAAAAAATGGCTAAGCTTGACTTATAGACATAATAAATAAAATAGAAAACAGAAGAAGGAAGAAAAAAGAATGGCAATAATAATTAAGTAGATTCAGACATTATATTTATAAAATAATACCATAAGAAATCAAAAGTTGGAGAATTATTAGAGGAATTTAACTAAATTTATGACTTAAAGACTAAAAAGATGAAAAAACTTTTTTGGAGATTTGAAGAAAAGCAACTTAAAGAAGTTTAGGATGTATTTGAAAGAAGCTTCAATTTGAATTAGGATGTAGTAACTCATTAACACATCTTAGAAAGACTTACTTTTAGCAATTTATAGACTCTCAGGTAGCCTAATTGGCTTAATGATGAAGTTATCAATGCTTATATAAGATTAATAGTGTAATCAACAAATGCAGTCATATTAAATACCTTTTTCTATCCTGAGTTGGTAAAAAACAGTGCTTGGAATAAAATCAAAAGAATAGCAACTAAAAATAAAGTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,012.7 L-2963.1 L-3641.0 S-0974.5 S-3898.8
S-6896.6 S-91,161.5 S-12911.3 S-151,018.4 S-241,162.7
C-01,241.9 C-26,540.8 C-48,186.1 C-613,487.5 C-813,993.0
C-104,619.7 C-121,826.3 C-141,819.8 C-162,656.3 C-181,901.9