Summary
Transcript IDgene_000004949
Gene IDTTHERM_00348170
Length2697 bp
Sequence
ATAAGCAAATTTATACTTAATCAAATTTTATGAAGCAAGGTACCATTAAAAACTTCTTTGGAAATAGCCAAAAGAAAAAGGAAGAATTAGGTGAAAGCAATTTAGGTTCTGACAAAAAATGTGCTACTCAGTCTCAAAAAGGTGCTGAGACAAATGGTTAAAACTCAAAGGAATCCCAATAAAAGCCTGATGAATCAAAATCATAGCAAGAAGAATCTTAATTAAAAGAAAAACCAAAAGCATAAAAAAGAAGATAAATAATAGATAGCAGTGATGATGAAGAAGTTCCTTCATTGGCTACGATGTCTATAAGTAATAAGTAAATAAAAAAAGTGGAAAATGAGAACTAAAAAAATGAGTCTTCTAAATCAGAAACAAAATCATCCACAGATTCTAGCAATTTGTCGAAATAAATACTTGAAAAACCAAAAAATGAAGATGAAAAATTAAGCCAATCATCTAAAAAAGCAGCAGAATAATAAGATACAAAAAAGAAACCAACTAATAATTTGAGAAAACTTTTGGATAAGCACTTTGACCCTATTGAAGACGCTCCATTCTATAAGGATTAAGAAGTCTTGTTTGGTTATTTATGTGATGGATTTGAAAGAGTAAATGAACAGGAAGGTAAAAATTCAAAGGCTATACAAATTGAAATAATGTCAAAAATTTTCAAGTCGATCATATTACTTAATCCTGACTAGGTATATGAAGCTTATATGTTTTGTATTTTAAAGATAGCACCTGATTATGAGTCTAATGAGCTTGGTGTGGGTAGGGAAATACTTTAAAAAGCAATTAGTAATTGTTGTGGTAAATCAGTTACTTAAATCAGAGATAGCCTTAATAAACTTGGTGACTTAGGTAAGGTTGCGTCCGAAGCCAAATCTACCTAAAAAAACATCACAAATTATTTTTAAAAGCAGGCTAAAGAAAAGCCTCCTATTACTCTTAATAGAACTTTTAATGATTTGAAAAGTATTGCAGCTGCTTCAGGAAAGGACTCAACTGCAGAAAGAGAAAGAATTATTATAAAATATATGAATGAAGCAAAACCAGATGAAGCATGCTATTTTATTAGATTTTTAGAGTAGAATTTGAAAATTGGTGCTGCTGAAAAAACAATGTAGGCAGCTCTTTCCAAAGCATTCTTTGAAATTGCCCACAATATCAAAAGCAATCACGTTTACACAGAATAATAAAACTAACTTTTAGAAGAATTTAACTTCAATATCACTAGATGTCTGTGTGAGTTTCCAAACTATTACTAAGTCATTGAGACTTTGAAATAAATTGGCAAAGATATTTCTAAATTATTAGATATCTGCAAGATCACGATAGGCGTTCCCTGCAAGCCTATGCTTGCCAAACCAACAAAATCAATTTAAGTTATTTTGGAAAGATTCAAAGACATGACTTTTACTTGTGAATACAAGTATGATGGATTGAGAGGTCAAATACACTACGATGGAAAAGATGTTACTATTTTTAGCAGAAACCTAGAAAATATGACATAGATGTATCCTGATATTGTAGAATTCATAAAAAAACATGTCAGCTAATCGAAAACTGTTAAAAATTTTATTTTAGATAGTGAAATTGTAGCTTTTGATAAAAACACCAACAAAATTAGACCTTTCTAATAATTAGCAACAAGAGGAAGAGTCAATGTCAAATTAGATGAAATTGATATAAAAGTTTGTGTTTTTATGTTCGATTTAATATATATCAATGACTAGAGTTTGCTACAAACAACACTTTAAGAAAGAAGATAAAAAATTTAGGAGTGTTTTGTTCAAGAACCTGGTGAGTTCTGCTTTGCTGAGCACATAAACACTGAAGATGTTGAACAAATTTAAGAATTCTTAGAAAAATCTGTTAAGGTGGGATGTGAAGGCTTGATGGTTAAAACTTTAGAAACTAACTCAACTTATGAACCAGCAAAAAGATCATTTAAATGGCTTAAACTCAAAAAAGATTATTTAGATAGTGGGTTAGGAGATACACTTGATTTAGTTCCGATTGCAGCCTTCAAGGGTACAGGTAAAAGAGTTGGATTGTATGGTGCTTACCTATTAGCTTGCTACAATGAAGATATGGAACGTTATGAAACAATATGTAAAATAGGTACAGGATTTTCAGATGAAATCTTAGAAGCATGCTATAAATTCTTCTAAGATAAAATTATACCATAGCCATAATCTGATTATTTAACCAAAGATTTTAAAGCAGATGTATGGTTTAAACCTTCTGTAGTTTGGGAAATTAAGGGAGCAGATTTACAAATATCACCAGTATATACTTGTGCAATTAGTGAAACAAATTAAGAAAAAGGTATTGGTCTTAGATTCCCTCGTCTTATCAGAGTTAGAGATGATAAAGATCCAGTCGATGCTACTTCTCCTTCTTTTATATACGATATATATAAACAATAAGCTGTTGTAGCAAATGATTTTGATGATGGTGATGATTTCTATTGATTAGCTTAATTAAATAAAAAAGAATTTTTATCAATTTTTAGTCTGAATTCATGCTTCAAAATTATTTTTTGTTAATTTGAAAAAATTATTAAAGACTTTTATTTATGTTTAATAATAATTTTTAAATTATGAAAAATAAATATATTGAGTAAAAATTGATCATTCAGTATTAACTATAATCTTAAAGTAAAGTTGCTGAAACTAAAAATAAATGAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1486.1 L-2477.0 L-3299.8 S-0142.0 S-3147.9
S-6109.3 S-9128.6 S-12128.0 S-1582.7 S-2493.4
C-0154.2 C-2313.3 C-44,054.0 C-62,625.0 C-8987.9
C-10635.5 C-12457.2 C-14547.5 C-16352.3 C-18178.8