Summary
Transcript IDgene_000004964
Gene IDTTHERM_00347920
Length1442 bp
Sequence
AAGTAAGTAGTCCGCAGTCAATATTAAAAGCAAAAGATTTCAAAAGGGAATTAAAAGGAAAAATGGACACAGAGTTTTAAAAAAAGCTGATTCCAAAAGTGTAAAGTAGAGAAGATATATTAAATGAATCTTATAAAAATTCTATACATGCTTTTCTATACGAAAATAAAGTTTATGATTGCTTACCAAAAAACTCATAAGTAGTAGTTATAGATAAAAATTTTTCTTGTGCCGAAGCCATGAATTTAGTTATAAAAAATGACTTTGAAGAAGCTATTATTTGGAATTAGGATACATCGTAGTTTGATGGAATTATTACTTATTCTGATATTGTCAATATTATTTTGAAAAGCTATAAAAACGTCGCTCTAGGCTAAATTCCTTTAAGCGATAGCTAAAGATAAACACAAGGATTTGATAAGCTTCAAGAGGAATTCAAAAAGTTTAATGAAGATGATTAAATGGCCGATGATAATGATGTGGGAGTTTATAGTAAGAATGAAAATGAAATGGAGGACGAAGACATTAAATTAAATAATAACAAAACATCTATTCCTATGAATCAAAGCATAAAGCTTAAAGGGTAAGAGTAAGAGTTTCATGCAGAAAACTACCCCTTTAATGAAGATTAGAAACAAATTTTTCTTTCAGATTTACAAAAACTTTCTGTAAGAGGGTGGTTTAGAATACTTAATCAAGATGAGTATGAAAGTAAGGAACTCATATCTGTGACTTTAGAAGCGAAACTTTAAGAAGCTTGCTCAAAAATGATAGAACATAAAATACACAGAATCCTCGTTATAGATTAGGAAAGTTAGTTAGTTGTAGGTATCCTGACATATAAAGATATTTTGCTCTTTTTAATTAGAAATCTAACGTAAGATTTCCAAGGTGATGAAAAAGATGATTAATACGATATTCCTATTTCTTACGCTATGGATTAACTTTGCATATAAGAAGTTTTATCATGTAATCATCTTGACACTACATATAACGCCTTTGATGTTATGATGAATAAATGGAAGGTATCATCTGTACCTATTGTGGGTGAAAATAATGCATATATGGGACTAATACATCGCAGAGATATAGTTTTTATTTGGAAAACTTAAAATTTTGGAATTTTAAGTAGACCTGTACATGAATTCATGGTTTTCTTAAAAGAATAAAAGTAAAAATATAAATTGATGAGCTTAGAAGTGAATGAATTTTTTGAACCAAATGATTGCGTTCGAAAGGTTGTGGAAAATTTATTTTTAGCTTAAGGAAATAGATTGGTTTCGATTAATAAATAAACATAATAACTTGATAAATTTATAACTTTAAGTGATATATTCTAGTATTACTTGCAAGATAATTGATAAAATCTACATAATTTATATTCTCCTAATCCCTTTAGTATCTTTTTATATATTAATTCTAATATATCTATTTATCTATCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,558.8 L-22,470.5 L-32,071.4 S-0696.4 S-31,001.6
S-61,032.3 S-91,023.6 S-121,076.1 S-151,155.1 S-241,183.7
C-0748.5 C-2886.3 C-4540.9 C-6554.3 C-8793.4
C-101,100.4 C-121,237.1 C-141,428.6 C-161,008.3 C-18747.0