Summary
Transcript IDgene_000004994
Gene IDTTHERM_00444560
Length1343 bp
Sequence
AAAATACAGAAAAAAAAAGTGTTAACAAATTATGGATATAGAAAGCAATAAAATATAGGATAATAGCTAAAGTAAAAATGATTACTTTAAAAGATAAAAAACCATTCCAGGATGGAATTAAGAAATTGTGTCCAATACAACTGCATTAGTTCTTGGAGCAGGTGGTTTAGGTAGTTGTGTTTCAATTCAATTAATGAGACTTGGCATTAAAAAACTTATTTTAGTTGATTATGATGTTGTTGACTATCATAATTTGAATCGCTAAATTATGTTTACTATAAATGACATTGGTAAATCAAAAGTTGAGAGTGCAAAGTAGAATTTATAGTTCCATAATATAAGTAATACAGAAATAGAAACACATAATATTAATGCTGTAACATAGTGGGAATAAATTGTAGCTTTAGCTAAGTAGTCAAATTTAGTTTTTAACTTAATAGATTATGGTGATTATTTTGATTTAGCAGTATGTAGTCTATGTATAAAACTTTCTCTCCCTATGTTTTAAGGAGGTACTTTTTGCAACTCGTTATCTGTTGATTATTTTACTTCTGATGGTAGACCATGCCTTCTTTGTTTAACTGATGGTTTAAAAAAGGAGTTTATTGAAAAATTAAATCCTTCTCTTATCCTCGAATACAAATCTTTGGAATTTTTACCCAAAAACGATAACCCTGAAGGATAATCAAACATAGTTATTTGTTAAATGTGTGCAAACTTTATTAACACATTTGTCTTGAATGAGCTATTTCCATCTGGGCAGAAAAAATCAAAGCGTATCCTCCTTTATTTAGATCCTATAGATATAATATCTTTTGATTTAGAAATAACTCCTAAATGCCCTTATTGCAGAGAGCCTTTTCATGAAGGAAATAGTTTCCATGAAGTGCAATCAGAAGAAATCCCATTAAGCAAAGAAGACCTATGGAAAGATATTAAAAATTTATAACTCTAAAAACTTTTCCCATAATATGTCTAGGAAATATAAGTAATTGAGGGTAGTTTAGGATAAATAGATAGTAAATTATAAATCACTTATAAAGATGGAGCTAAATGGACAGTTTAATTAGTTGAAATATCAAGCATAAAGTAAACTATTGTGTATGATGTTATTTAAACATAGCCTTAATTCAGCTGCAAAAAATTTAGAAATATATTTTAAATTTCTTAGCCAGATAATCAAAATGCATTAAATACTTGTGAATTATTATGGAGGACAGAATTTTAGGATGACATCACTATTAACGCTTATGAAGATACAAAATATAAAAAATATGATTACTTTAAAAATCTAATTGAAACAATTATCACAAATTCAAAAAATGAAGAAGATTAAAATAAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1746.4 L-2750.4 L-3580.7 S-0655.0 S-3523.6
S-6558.6 S-9543.8 S-12736.3 S-15723.1 S-24739.1
C-0392.9 C-2538.8 C-4520.8 C-6312.3 C-8246.1
C-10376.4 C-12326.9 C-14547.3 C-16640.5 C-18493.0