Summary
Transcript IDgene_000005023
Gene IDTTHERM_00445920
Length1963 bp
Sequence
AAATTAAATAAAATATTGAAAGGATATATACTTAGTATATCAAAAGTATAAAATCATTTGTTTGAAAAATAAATATGGTTAAAAGTAGATTAGCTGCAATATTGCTCTTGTTTGCAGTCTAAAGCTTATTGGTATAAGCTGATTTACCTGTTCATTGCGTTAGATCTTAAATAACTGGTAAATGGTTACTTAAAGAAGGAAAAGTTCTAGCATCAAGTAATAACAAGCCTGTTTCTTGTGGTCATTAAATTCCTGATAAAGCAGAATCAAGCAATAGCGCCATGGGTGGTGTTTTAACTGAAGTTGAAAGAGAGTATGAAGTATTTTTAGATGAAGACTTCACAGTAAGAGGAAAAGAAGGTAAAGGTAGATGGACCTTAGTCTATGATGAAGGTTGGGAAATTGAATATAATGGAGTTAAATATACTCACTTTTTTAAGTATGCTAAAGACGACTCAGGATAATATAAATCTGTTTGCTCTCAAACCTTAGTTGGTTGGTTCAACCACATTCAAAAAAAATCTAGAGGATGCTCTTAAGCTATTAAAGCAGACGCATCTTAAGAATTCTCAGATAATGTATAGTAAGCTCATGTTGTATAACCCAAGGAAACTCAATACATTTTTTCTGAAATTTCATCTACAATGAATAAATTAAGCAGCTAATAAGAATAATAAAAAAGCTAAAAAATTAATGCTTCTAACTCTCTTAAAAGATAATAGCTTTCTTCCAAAAACAAGTTCCATCAATCAATTTACTTGAAGCCTCATGAAAATGTATTTGCTTAAATGAAACAAACACCTGCAACATTATTAAACCATTAAGAAATCGTTAAGAGATTAAACTCAATTAAAGGAAGTACATGGTAAGCTAAAGTTCCTTCTTTCATAAGCAAAATGAGTCTTGAGTAGATGAACACAAGAGCTGGTCTAAGAATGGATAAGCCTAAATTCAGTTACGACAACAAATAAGGCTCCTTTATTTAAAAATCATCATCTTCCTTGAGAGGTAACAAAGCAACTACCGATTATGCCCACTTTTCTATGGAGAACATATCAGATCTTCCTAAGTCTTTTGATTGGGCTGAATATATCCATGCTCCTCGTTCTTAAGAAGATTGTGGAAGTTGCTATGCTATTGCCACAACTTCTATGCTTTCATCTCGTTTGTGGATTAAATACGGTGATAATACTTAACTCTCACCCCAACACTCCTTGGCATGTAATTATTATAACTAAGGTTGCGATGGTGGTTATGGATTTTTGGTAAGCAAATTTTACAGTGAGTTCGAAGCTGTCCCTGAAAGTTGTCATCCTTATGAAGCTAGAGATGGTTAATGCAATCATTGCAATGTCGAATCTCTCAGTGAAGTATTCACAGTTACTGATTACGAATATATCGGTGGATCATATGGAAAATCAACTGAAAGATTGATGATGGAAGAAATATATAAAAACGGTCCTATTGTAGTCAGTTTTGAACCTAAAATGGATTTCATGTATTACAACAAGGGTATATATCACTCAGTTGATGCTAACCAATGGATTTAAAACAATGAAGAAAATCCTGTCTGGTAAAAAGTTGATCACTCAGTTCTCTGCTATGGTTGGGGAGAAGATGAAAACGGCAAATTCTGGTTATTACAAAACTCATGGGGTGAAGAATGGGGTGAGAATGGTAACTTCAGAATGAGAAGAGGAACTGATGAATCAAACATTGAAAGTATGGGTGAAAGAGCTAATATTGTAAAGACTGCAAGAAAATCTCCTAACACAACTGAATTTTCATCAACTTATTCATCTCACTCAGACAAATACTTTGTTGAAAAATCTAAAAGAAAATAATGATAAATGAAAAATAAATATTTTAATAATTACAAATAAAGAAATATAAAATATTATTTTTGGTATTGTTTTTAACAGTATTTTTATACAATAAATCTTGATCGATTCAGAATACAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-19,183.2 L-25,332.6 L-313,089.8 S-029,948.7 S-327,206.2
S-615,313.7 S-97,480.9 S-123,408.4 S-152,243.4 S-242,676.5
C-018,700.6 C-226,675.8 C-415,849.1 C-65,415.4 C-82,932.0
C-104,069.3 C-127,164.8 C-149,939.5 C-1614,102.5 C-1813,021.7