Summary
Transcript IDgene_000005044
Gene IDTTHERM_00446400
Length4362 bp
Sequence
GATTAAGAAGAATATCTATTAATAATTTAGATCAAAAAATTTATTATTTAGCGATATTTCAAATCAATTCTATTCTTATTTTTTAGAGAAAAAGTTAATTTTGATTAAAAGCTATAATAAGTATAATATAATTGTCTAGAGGAATCACATAAAAATGAATTAAGAATCAACTTCAAAAGTATAAGCATAAATGGAAGAAGAAATACCCACTGCTAAATCAGTTGTTAAACATACTTAAAGTCTGCTCAAAAATTCGGTTCTGAGATAAAATTTAGCTGGTAAGAGCGAGCAAAGACTTATTGTAAAGTAAATCGTGCTTGAAAACTTTAAGAGTTATTAAGGTAGATAAGTTATTGGTCCTTTCCATAAAAGATTTACTTCCGTTGTTGGGCCTAATGGTAGTGGTAAATCAAACTTGATTGAGTCTCTTCTTTTCGTATTTGGTAAAAAAGCTTCCTGGATGCGTCTCAAAAAACTTGAATAACTCATTCATAACTCTTCAAAGCATTAAAATGTTAAAAAAGCTTCTGTCGAAGTTACTTTCCATGAAATTAGAGATAAAGAAGGCGAAGAATATGAAGTTATTCCTGGAACTGAATTCACTGTTAGAAGAACAGTTAATAAATCTAGTGTTTCAAAATACGAGATCAACGATAAAGAAGTATCTCATGTAGAAGTTACTGATACTCTTAAATAGAAGGGTATTGATCTTACTAATAACCGTTTCTTAATTCTTTAAGGTGAAGTAGAGTAAATTTCACTTATGAAGCCTCGTTCTGGAGATCCAGAAAAACCTGGTTTGCTTGAATATTTGGAAGATATTATAGGTTCTAATTAATTCAAAGAAGATATTGAAAAGAAAGACGAAGAATATGAAGTCCTCTAGAATGAAAGAAGAGAAAAGGGAGAAAGAATGAGAATACACGAAGCTGATTTAGAAAAGCTATAAGAATCTAAGAATTTAGCCATCGAATACATTCGTAATGAAAAACTAAGCTATTAAATGACAAATATTATTGGATAGATCGATCTTTTAAGAAGTAAAAAAGATATAGAAAAGTTTGAAACAAAGATCAAATAAAATGAGCAATAAAATGTTGAAATGAGAGAAAAATTCAAATAGTAATTAAAGGAAAACGAACAAGTTATCAAAGAATATAAGCAAAGCAAAGCTGAAATAGAAAAAAAGGATTATGAAGTGTAAAAGTATAAAGGTCAATTAAAAAAATTGAATGAACGTGATGAATTAATTAGACAAAAGTTAGTATTAGAAACTGAAAACTAAACTAAAGCTGAGAAATAACTTGAAGATCTTCAAGATGAATATAAAAAAGCTATTCGTGATTAAAAAGAATATCAATCTGAATTGCCAGAAAAGTAAGATAGATTAAGAAAATTATTGACTAAAAAAGATGACGAAGATGAAAAGCTTAGAGAATTAAAAAGCAAAGTTAACAACGAAAACCAAAAGTTAGTTAAGGAAAAAAAAGAAATGGAAAAAAAATTATAACCAATTAAGGAGAAAAAACTTGAAGTTTAATCGAAGAGAGACACACTTTAAAACAGGTTTACTTTGATTTCTCAAGATGCCACAGCTATTTAAAATGAATATGAAAAGAATTAAAATGAATTAGAAAAAGCTAAATAATTAATAGAAGATTAGCATACATTGATTAAATAAATTGCTTAAGCTATTTAAGCCATTGAAGCAGGATATGAAAAATAAGAAGCTGATAATAAGGAATGTAGGATTATTGAAGAAAAAATTATTAAAGCCATTTCTGAATGCAAACAAAAAATTGATTAAACAAAATAATCTAATTAAGACTCTCAAACAAGAAATAAGGTTTTAAACGAATTAATGATAGCTTAACAATAAGGAAAGCTTAGAGGTATTTGTGGAAGATTGGGTGATTTAGCAGCTATCAATGAAGAATATGATGTTGCCATAACTACAGCATGTGGTCAATTAGACAATATTATTGTAGATAGATATGATGATGCTTAGAATGCAGTCAATTACTTGAGAAAGGAAAAAATTGGTAAAGCTTAATTTATTGCTTTAGATAAAATAGAACATAATAGATAATATATGGAAAAATAATTCTAATGTCCTAGAGGATCATAGAGATTATTTGATTTAATTTAATTCAAAGATTAGAAATATAAAGTTGCTTTTTACTTTGCTTTGAGAAATACTTTGGTTTGTGATAACATTGATCTTGCTACAGAAATAGCTTATGGTCAATAAAGACATAGAGTAGTCACTAAAAAAGGAGAATTAATTGATGATTCTGGTGTTATGTCTGGTGGTGGTGCTGCTAGAAGAGGTGGTATGGCCTCTCAATTAAAAGTGGAGATTTCTCCTGAGGAGGTTGAAAGATATCAAGCAGAATATAGCAGAAACTAATAAGACTTAGAATAAATTAGAGAAACAATTTAGAATACAAATAAGTAACTAAACACATTTATTTAGGAAAAGATGTACTTGGTAAAGTAGCTCGAAGCTAAGAAGTTTGATTAATAATTGTAGGAAGATAATGTAACCAGATGCCAAAATAGACTAAAAGCTCTTTAAAAGTAAATGGACGAATAAGAATAGAATGCAAAAGAAAGATAAGTCATCAAGTAGGAACTTGAAAAATTTGAAAGTGAATATCATGAATATGATGGATAAATCATGGAATTAAATAAAAAAATAACCGATATTGATGAGAAAATTAACAAATCAGGTGGCTAAGAACTTAAGCAATAACAAGAAATTTGCAAGAATATTTAAAATTAAACCTTAGAGTTGCAAGCAGACGTCAACAAAAAAACTGCTAAATTAAAAGACTTAGAAAAAACTTTAAAGAACAACGAAAGAGAAAAGAATGAGACATAGGAGAGAATCAAAAAAATAAAAGCTAGTATTGATCCATTAAAAGATTAGTAATAAAAACTTGAAGAAGATGCTGTTAAGGTATTCAAAGATTAACAATAAGCTGAATAGCAGTTAGCAATGTTACAAGAGTAGCAAAAGCAAAGAGATGAATAAAAGGCTGGAATTGAAAAAATTATTAAAGATATGAAGGATGCTTTAGAGAAATTAAAAAAAGAAAAAGATGACTTTGAAGCTAAAATTAACAAAGCAAAAGAAGATTAGAACAGAAGTGAACATGTTATTGCCAATAACAGAAATACTTACAAAGAAATTACTAAATCATATGATTTCTTACAATTCATTGATGAAATTGCTGGCTATTAAATTAATGAGAGTGAGGATAAGAAATCTGATGACCAAAATAATTTAGATAATATTTCTATCCTTGAAGAATCTATCATGCAATCTATGATGGATGAAGAGAAAAACACTTAAGATAAAGAGGATGATGAAGAAATTCCAGAAAATAATGATAAATAAAATAAAAAAATTAGATCAAGCAAAAACACTAAGAAAATAAGTAGTATTGATGTTTATGATGATATTGGTTAAGAATTGATTGAATAACTTGAAAATCACAGAGAATCATTAAAAATTGAAAAGGCTAAGGCTGAAGAAAAATTAAAGAGCATGACTAACGATGCCAACATCACTACTATTACTGAATTTAAAAATAAGTACATTGAATTTAAGTCCAAAAAGGAAGAATTTGAAAGAGTTAAAAATAGAATCTCAGAGCTTAAAGTAGATATTGATCGTCTTAAAAAAGAAAGATTTGAAAAATTCATGAGCGGCTTTAACCTTATCTCAGCTAAGCTAAAAGAAACATATTAAACATTAACAAATGGTGGTGATGCTGAACTTGAATTAATTGACTCTCTCGATCCTTTCTCAGATGGTGTTAATTTCACAGTAAGACCTCCTAAAAAATCTTGGAAATAAATCTCAAAGCTATCAGGTGGTGAAAAGACTTTAAGTTCTCTTTCTTTAGTTTTTGCTTTGCATTATTACAAGCCAACTCCATTATACTTTATGGATGAAATCGATGCTGCCTTAGATTTCAAGAATGTATCAATTGTTGGTAATTATATCCAAGAAAGAACTAAAAATGCACAATTCATTATTATTTCCTTAAGAAATAATATGTTTGAGCTTGCCAACAAATTAGTTGGAGTCTACAAAACATACGATACTACTAAAACTATTGCAATCATTCCTGAATTAATTTATTAAAAAATTCAACACTTGAATGATGATAAGACTGACACTAATTAAAACTAGAATGAAGATAAAGACAATAAGAGCAACTGATAAAAAATAGTTTCAAATAATTAAATTAATGTTTTGTAATCAATCTATCTATCTATCTATCCATCCATCCATACTTTATTATTTTAGAGTGAGTGTAATTTTAAAATCATCTATTTTCCTTAATAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,478.6 L-24,181.0 L-33,773.3 S-01,821.1 S-32,109.8
S-61,033.9 S-91,435.2 S-121,561.9 S-151,760.4 S-241,825.4
C-01,235.0 C-211,387.7 C-415,979.6 C-618,498.0 C-814,052.1
C-1013,019.5 C-128,384.0 C-147,991.5 C-166,059.6 C-184,644.8