Summary
Transcript IDgene_000005052
Gene IDTTHERM_00446520
Length592 bp
Sequence
AAATAAATCAAATAAATTTGCAATAAATAAATCAATTAATAATTTAGTAATTATTTAGTAAACATAAAGTAAAAAGCCAAATATTCACAAAAATGATGCAAGATTTTACCAACCAATTAGATATTTAAGGAGGTCTTCCATGGACTAAGAAGAATGAAAATATTGAAAAACATCCAGTACAAACTATATAAGAAATGAGATTATATGGCTAAGAAGAAGCCAAAATGAAGACTTACTCTAATCTTTATGGTTCATAATTTCCTATGTTGTTGACTATTGAAAGAAACATCCTTGCTTAACCATCCAGACTTCCTGGTGAAAAATAATCATTATTAGGTCTTGATATTATGATGAATAGATTGAACTAAATTGAATTCGAAGATTTCTTGGGAACTGATAATCCTGAAATGCATAAACTTAATGCTCATGAACGTTTCTTAAAGAGCTTCGATTGAAATCGAAACTAATTTGGATTTTGGGAAACTAACTAAACGAAGATGCATTAAATATAGTTTTAAATTCGTATTGTTTATATTTTTTATCAGTAAAATAGCTAACTAACTATAAAAGTATATAAAAATGATAAAAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-111,788.2 L-211,752.0 L-310,442.9 S-021,251.9 S-39,062.2
S-610,862.8 S-98,245.6 S-126,855.0 S-157,126.7 S-246,844.7
C-02,026.4 C-21,822.2 C-42,467.0 C-61,720.3 C-81,987.5
C-102,074.4 C-122,327.2 C-142,609.5 C-162,926.2 C-182,527.1