Summary
Transcript IDgene_000005086
Gene IDTTHERM_00327300
Length2066 bp
Sequence
GTTAAGTGATTGTTTAATAAAAATTCAAAGATAATAATGATAGCTAAAATTATAAACACATGTACATATCTTCCATTTTTGAAAATTTAGATCAAAATAATGAGAAATATATAGGCATTAAAAAAATTCTCAACTAAATTACTGAATATGAAGAGCAAGAAATATTACCTATTTTAATGGAAATCAATCCAAATGTTAATTATGATCGCATAAGTGAAGCTGAGTTTATTTAACTCTATTTGCGTCTCAATTTAATTCCAGAAAATTTTGAAAAAAACTAGATCCCATTTACATTTGCAGGAAATAAGCATATTGCTGTATGCTACAAAAGCTTTCCTGAAAGCAGAGATATTTTAGACAACTAAGATGAATTGGATATTATGAAATAATTAAGTGATTTAGGATATGGCTTAGATGCAGCTAAAAATTATAGACTTATGCTTATGAAAAATGCCAATCAGAGTTGGCGTAAAGTAAGTTCAGATCTTTGGCAATGGGTTTAACAATTAAAAGATGAATCATCTATTTAGTATTAAAATAGTTAACCTAAGCAAAATTAATAAAATGTAGTAGAGTTAAATAATATCTTAGAGTAAATTTAAAAAACTGATTAAGGCATAAACTTAAACATAAAGTAATTTTACCACCACAGACTATACGACTTTAATAATAAATAGAGATAATAATGTCTAAAGATATTTAAATGGGCTAACCTTCCTCTTGCTAGTTAATCTGATCAAGGAACTTAAGCATTTTTCCAACAAATTAAGTAATTTGACGAAACCAACTAGCACATAAGAGCTGCAACAATTGCTTCTTTTCATTTTGAATTTGATAGAGCTCTTGATAGCTTAAATAGTGCTTTAGAAGATGATCCTTAATTGAGAATGATGAAGAGTGTATTATTAATTTTAAAAAATATATAAATTAGCATTTAAGGAGATTAATATGTGAAGAATAGACTTGAAAGTATTTATCCTTCTAACTCTAGAGATTATACAGAGTAAGATATGTCATAAGAAGATATTAAGAATGCAAAAAATACTAATTTTAAGAATTAAGAGATTTAATCTGAGTTTAAAAATATAATTAACAATGATCTGAGATATACAATTGTATAAAACGAATTAAACTTTATTTCAAATCTTCTCAAAGACATCAAATTTAATAATCCCTACTTGACTGCTCTGGCTAGATTCTTAAATAACGATGATCCTTAGGAAAGAGTAAAGGAAATCATTTAATAGGATGGCATCGAAATATTTGACAAGATTGCATTTGCTTTAAGATTTTTAGACGATGATAATATAATTACTTATTTTACAAATTTAGTTTAAAAAGCAGAATAGGAAGGTATTCTTGAATGCTTAATATTAGTTGGTAAAGATTAAAAAGCCATAGATATCATCTAAGCTTTCATAGATAATACAAGAGATATTTAGACAGCCGGTCTACTCTCTGCACATTTGAATTTACATAAATATGAGCCTTCAGAAACTCTCTAAAATTGGTTTAAAAATTATAAAGCCCTTTTAAATAACATGAATTTGTTTGAAAAGCGTATTACTCTTGATAAAGAATTTAAAAATTTAAAATAACTCCTATGCAAGACTGATTCAGAATAAAATAAATCTTCCTTTAAGGGATCAAAGATATTTTTAGAGTGTAAGCAATGCAATAACTGTCTAGACAATAAAACATAATTAGATAATATTATAAGAAGAAGAAGCATAAGAGGTTATGCTGCCTTGTTACAAGTTTTAAAGCCTATGATAGGTGTTTGTCCTTCTTGCTGTGTTATGCTGCCTGTTTGCTGCGTTTGTTTATTGTCTTGTGAACTTGTAAACCCTTACATATAATTTAACAGAAACAGATAACAATAAAATTAAATGGGAGGTTAGATTGAAAATCTTAACTTAGAAGAAGGAATTGTGTGGTGTTAGTCATGCAATCACGGAGGCCATTATAAACACATAATTGAATGGTTTTAAGATTTTGATGTTTGTCCAGTGAGCGATTGCAGCTGCAAATGTTCAGTGATTTGATAAAAACGAATTAATTTTAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,201.8 L-23,364.8 L-32,726.1 S-0345.8 S-3931.1
S-61,918.7 S-91,481.7 S-121,051.8 S-151,269.6 S-241,201.2
C-0902.3 C-2504.1 C-4409.4 C-65,069.9 C-83,828.0
C-102,239.6 C-121,133.7 C-14918.9 C-161,599.9 C-181,703.6