Summary
Transcript IDgene_000005145
Gene IDTTHERM_00237640
Length2206 bp
Sequence
AAATAAGTAGCCATAGCTTGATAATAATAACAAACTTCTCAAAATACTTAACAAGGATAAAAATATTAATAGGTATACTCTCTAAAATATAAATATAGGGTACTATTTTTGAAATTAGTAACAATGTCAGAAGAAATAAAACCCGTAATTGCTTCATGCAGTAATATAGTACTTACTCATGATTTATAAAATCCTTATCCTCTACTGAGTAAAAGACCACACGAAGGAAATGTTAATTGCGTAGTATGGAACCACAACAACCTTGTACTAGCAAGCTGTGGTAATGATGGTAAAATAGTACTTTCTAACTCAAGAAAATAAGGAAATCTCATATAATTTGATGATGATATTTAAAATAGTTCTCCATTAACTTCAATATAATTTACTTCTGCTTCAACTAAATTAGCAAGCGGAGGAAGCAATGGAAGAGTTAAAATATACGATTTGAAGAATTAATGTATAGCAAAAACATATTCTAATCATTTTGGAGGTGTAACTTGTGTTGATTGGCATTAAAATGATTACATTTTAGCAAGCAGTAGTTAAGTTGGCGATATTTTTCTATATAATACAGAGAATGATTAATAAGTAGCTACATTTAGTGAAAATAATTCAGTTCAGCAAATAAAATTTTCTCCATAGAGAAATAACTACTTAGCTTCTTGTTGTGGAGATGGCAGAGTAAGCTTTTGGGATGTAAATACAAAATAATAAATTGCTGTCTTTTAAAATCATCAAAGTAAAGTAAATTCTGTGACTTTTTCTCCCCATAACAGAGTACTTGCAACCTCAGCTTCTTTGGATGCTACAATTAACTTATATGATATAAACGAAAAAAAAGTGGTCAAGAAACTATCATGTGATTCACCAATAACTTCACTTGCTTTTCATAGTGATGGATACACACTTATAGCTGGTACATTGTATGGCGAGTTGATGGTTTATGATCTCAAAAATTTGCCAAAGCCTAAGCTACTGCTTGAAGGTCACACAAAAAATTAAGCAGTTAACTATATTAGTATAATAAAAAATAATGAATCCAGATCTCAAGTAAATTCAAGTGCACCTAATTCATAATAAGCACCAAATAATAAAACTAGCAGCTTAAAAGACATTTCATAAACAAAATACCCATAAAATTTAAGCTAAGCTAGTAATTAAGAGCAATCAATTTAAGGCACAAAATTAAATGATACAATTTCGTCTTAAAAATCAAAAACTTCAGAAACATCTTCTATAAACCCTTCCAAATTTAACTAAAACAATAATTATGGAAATTATTCTGATAGAGATATTTAATAGAAATAAATAAACAATAATAACAACAACTATAATATGACTTCTCCTTCAATAAATAACTCTAATGGAAAGTAATTTAGTAACAATTAGTTTGCACAACCATTAAATTAAAACACTAGCATAAAAGAAAGTGGAATTTAGTAGCAATCACCAGCTCCAATATCAAAGTAGTCTCAAATATCTAATTCAAATACTCTAGCTAATAACACAAACTTGCAAAATATTTAAAGTGGAAAAAGTTCTCAAATAATCTAAAATAATTACGATAATCAAAATATATCTACAATTAATTCTTAGTTGGCCAGAAAATCAAGTGCTAATTATCAAGAAGAAGACAATAAAGGATAAAATGGACTTTCTAAAAACTATAGTAGCAAGCATATCTATAATTAAAATTCCATGATTTTAAGCTCTACAAAATAGTCTACTTTATTATAATAAAATTAATTATCTTCTAGTAAATTATAATCACCTGGATAAGAAGATTACTCAGAGATGAAGAGATCAGGAATAACTAATGTTCAGCCCTATGAGTTACCACCAAAAGCCTCTACAATAATAGAAAGAACTAATGGCAAAAACCTATCATAATTATAGTAATAGCCTTCACTGCCTACTTAATAAGGGGATGATTTTACAAGCAAATAAAAATAATATATTAAAAATATGATGGAAGACTATTTTTTAGATATGAAATTTAGCTTTTCCGAGTAATTTTAGAACCTGCATATCGAAATAATCCGTTAATTTTAAATTTAATAGAATGAGTTAACAGCCCTACTTGAGTAATATGTGAACAAGAATAAAGCTTTGGAGGAAAAAATGTAATAGTTGTAGTTAGAAAATGATAGATTAAAAAAATCAACTTATTGAAGTTTGTTTGATTAGCTAATTAAGTTAAAAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,152.5 L-21,175.6 L-31,126.5 S-01,431.1 S-31,473.9
S-61,204.6 S-91,568.4 S-121,668.7 S-152,153.5 S-242,266.6
C-01,418.1 C-28,658.5 C-42,450.6 C-61,271.0 C-81,233.2
C-102,285.1 C-124,379.4 C-141,701.4 C-161,703.5 C-181,675.4