Summary
Transcript IDgene_000005173
Gene IDTTHERM_00239290
Length1927 bp
Sequence
AAAAAATCAAAGAAAAACAAAAATAATCAAATAAATTATATAATTTTCAAGCAAAACAAAATATTATCAAAATGTTCTAAGGCGGTCAACATCAAATTATGGTTTTAAACCAAAACACTAAGAGAGAAAGTGGTAAGAAGGCTCAATTAGCTAACATTAGCGCTTCCAAGGCTGTCTCTGAAATCGTAACTTCTACTTTAGGCCCTCGTTCTATGCTTAAGATGTTACTTGACCCTATGGGAGGTATTGTTATGACTAATGACGGTAACGCTATCTTGAGAGAAATCGATGTTAATCACCCTGCTGCTAAGTCCATGATTGAATTGGCTAGAGTCCAAGACGAAGAAGTTGGTGATGGTACTACTTCAGTTATCATTATGGCTGGTGAAATGATGTCTGCTGCCAAGCCCTTCATTGAAAGAGATATTCACCCTTCCATTATTGTCTCTTCTTACTACAGAGCTTTGGAAGAATCTATTAAAAAGATTGAAGAACTTGCCGTTCCCATTGATGTCAATGATGACGATAAGGTCAACAAGGCTTTATCTTGCTGTATTGGTACCAAATTCACTTCTAGATGGGGTAAATTGATTTCCGACTTAGCTCTCAAGGCTGTTAAAACTATCATGAGAGGTGGTAATCTCTAAAAACTCAATCTTGAAATCAAGAGATACGCCAAGGTTGAAAAGATCCCCGGTGGTACTTTGGAAGACAGTGTTGTTTTGGATGGTGTTATGTTCAACAAGGATATTACTCACCCCAAGATGAGAAGATAAATTAAAAATCCCAGAGTCATTTTACTTGACTGCCCTCTTGAATATAAGAAAGGTGAATCTATGACCAACCTTGAAATGATGAAGGAATCTGATATGACTGATGCCTTACAATAAGAAATGGAAGAATTAGCTTTAATGTGCAACGATATTTTAAAACACAAGCCCGATGTCGTTATTACCGAAAAGGGTGTTAGTGACTTAGCTCAACATTATTTATTAAAGTAAAACGTCTCTGTTATCAGAAGAGTTAGAAAGACCGATAATAATAGAATTTCCAGAGTTTCTGGTGCTACTATTGTCAACAGACCTGAAGAAATTCAAGAATCTGATGTTGGTAAAAAGTGTGGTATGTTCGAAGTTAAGTTAATTGGTGATGAATACTTCACTTTTATGACTGAATGTGAAAATCCTGAAGCTTGCTCTATTATTTTAAGAGGTGCTTCTAAGGATGTCCTCAACGAAATGGAAAGAAATCTCCACGATTGCTTGGCTGTTGCTAAGAACATTTTTGTTAATCCTAAGCTTGTTCCTGGTGGTGGTGCTATTGAAATGGAAGTCTCTTCTCACTTAGAAAAGATCTCTACTTCTATTGAAGGTCTTCACCAACTTCCTTTCAGAGCAGTTGCTTACGCTTTAGAAGCTATTCCTAAGACCTTGGCTCAAAACTGTGGTGTTGATGTTGTTAGAACCATCACTGAATTGAGAGCTAAGCATAATTAAGAAGGAAATAAATTTATTGGTATTGAAGGTAATACTGGTAAAATTACTGATATGGCTGAAGCTAATGTTTGGGAACCTGTTTCTGTCAAGCTCTAAGTTTATAAGACTGCCATTGAATCCGCTTGTATGCTTCTCCGTATAGATGATGTTGTTTCTGGTCTTAAGAAGCATAAGGTTGCCAAGGGTGGTGCCTCCGTTACTGATGCTTAAGGTCAAGAAATCCCTGAAACCTTCGGTGATGCCAGAGATGGTTGAATAATGTAATAATAATGAATAGAAAAATTAAAATAAAACCAAAAAAATTAACTCATATATTTCCAATAAAAAATTAATATATAATTTTCACATCAAAAGTTTTAATTGTATGATTTAAGTATTATTAATTATATAGTATGGTTAAAAATATTTTAATTCTATTATATCCAACTCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-127,082.3 L-225,287.4 L-315,344.5 S-04,778.8 S-38,141.5
S-610,378.4 S-912,061.1 S-1215,351.1 S-1520,249.2 S-2421,071.4
C-07,117.6 C-27,176.8 C-43,945.6 C-66,703.9 C-810,650.4
C-108,731.2 C-1210,904.5 C-1410,146.5 C-1612,142.0 C-1813,012.7