Summary
Transcript IDgene_000005209
Gene IDTTHERM_00242120
Length1168 bp
Sequence
GCTCTAAAGAAGTTTAACTGATTAAGATTGATTTGGATAAAAATGAAAGAGATAATGAAAAAACTCTCTTATCATAAAGCTCAACTATCAATTTGTTAAATTAGGAAAATCTTGCTTATGTTGGATTAGTATAAATTGGTACTCCTGCTTAAAATTTTTATGTTATATATGATACAGGTTCTAATGATCTTTTTGTTTAATAATATGGTTGTTAAGGGTGTACAGTTACACCTAGTTTAGGCTATACACCAAATGTCTATAAATCTTGGCTATCATCTACAAGCAGTGTTTCAACTAATAAAATATAGCTGAGTTATGGATCATTAACTGCATACGGATATAAAGGAAATGAAAGTGTTTGGTTAAATGGGCACGCTGCAACTGCATTTAAAATGATATTTGTTTATCAAGAAGGTAGTTCATAGTTTGGTAGTAAAAGTTCAGCTTTTGATGGTATAATGGGTTTGTCTAATGCCTAATCAAATATTAATATATTTGAATAAGGAAAATCGGAAGGAGTTTTAAATACTTCTCTCTTTGCATTTGATTTAGCAAATAATAAATTTTACTATGATGATATCGATTAAAAATATCTCGATGCTCCATCAGTACCTTGTTCCATGGATGATAGATGGACATTCACAATTTTAGGCCTTCATATTAATGGATAAGATTATACTGATAGTTTAAGCTCTTAAGATGGCTTAGTTGACTCAGGAACATCTTTGATTTATTTAAGCAATGGAGTTATATCTGCAATTGTAAATTCAAGTAGTAAATTTTCAAGTAGACTTTAAGGAGCATATAGCTTAGATAATTGTGCTGGTTGCTTATGCTAAGAAATCAATTTTCTTCCTGTAATAGAATTTTATTCAAGAGGAGCTTTAATACTGTTACCTCCTTCTTAGTACATGATGGTATATTCTTAATACTGTATATTGTCAATTTAAGACAGCTCATAATTCGGATTCAATCTTTTAGGTGATGCTTTTATGAGATAGCTAGTTGTTACATACAACAAATAAGATAATGAAATGACTTTCTATGGACCAAACAGCTCTTTTATGACTAACAAGAAAACTATACCAACTTTTATAGTTTTAACAGTATTTGCTGCATTAGGAATTTTAGCACTCCTTTTTGTTTCATATAGAGCTCATAAAGTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1703.2 L-2763.4 L-3799.0 S-0416.6 S-3533.0
S-6414.5 S-9455.5 S-12477.9 S-15442.2 S-24371.7
C-0658.8 C-2638.3 C-4297.4 C-6187.1 C-8185.0
C-10211.9 C-12120.4 C-14285.5 C-16271.3 C-18302.0