Summary
Transcript IDgene_000005231
Gene IDTTHERM_00071060
Length3753 bp
Sequence
AATTAATTAAATTCATAAAATCATTCTAATAAAATGACAAGGAGTGTTTATAAAAAATTACCCTCAAAAAATTAGAAAGTAAATAAAAATAAAAAAGAGAACGTTGTTGTTATATAAGCTAAATAATTAACTTCGTCTTCAAGAATTAACACTCAAAAGAAGTAAAATAAGACCAAGTACATTACTAAGAAAAATAAAAAAGTCACACCTAGGCAGAAAATTAGCAAAATCTCTCAAAATTAGCCTACTAGCTAAGATTAACCGTCAAATATATAAAACAAATATAATTTTAAAGATATTTAAAGAAAAATGCTTTACAGAAAAATATAATAAAATGATAGTATTTTAAAAAGCAAACCTTATTTTAACTACTTCCATTGCAAAGATTATGAAAAAGATCCCAGAAAGTGTGACAACTGCTTTGATAGTTAAATAACAGAAGAAAATGAAATGCTTTATTGTGAAGAATGCAATTCCTTTTTACATAAGCTTTGTTATAGTGTGTCTTAAGACTAGTTTGATCTTATAAATAAATAAGAAACCGAAGATGAGTGCAATTTTACTTTTGTAAAGTGTGAAAGCTGTTTAGAAAGAGAAATAAACCCAGAAATAGATATATAATGCTTAATATGTTAAAGAGATATAGGTATGATGAAATGCTTTTACTTTGATTCTAGAAGAGTAAAATTTTCTTCTAAGAAAAATAAACAATATTCAGACTACGAATACTTTATAGATAAAACACCTGTGCTATTGTTAAATGAGGAACAAATAAAAAACAATAAATATATCAAAAGAGTTTTTGCACATCCCCTCTGTATAAATAGCTCTTCTTGTCTCTTTATCTACCATTTTAAATTCTTACTTATTTGGGATGAAGAGGATTATAAGAAAAAAAGTAACTAAGGTAAGAAGTATAAATGCTCTTAGTGCAATCAAGGAAATGGCCTTCTCATTTAAATAAAATTACGATGCCAGACACATACATAGTAACCTAATTTAAGAAATATTTTATAAAAATAAAGTGTGAACACCAAAACAAATAATTTCCCTCATGCAAACAGTTCTACCACCCATTATGTGCAGCAGAAAAAAAAATGATATACTATCAATAAGGAATGAGACTTATCCATTAAAACTAATCTGTGAGATATTCAGATAAAGAAGAAAATATTACTTATTACTACATTATATGCAATAATCATATTGCTCAGATCTTTTAATAAAAATAATCTTATGGCTTTTTTAATGATAAATAACAGATTTACAGCTAATTAAAAATGAATACAGAAGAAGAACAAAAGAATTACGATGATTGGATACAGTAAATGATAGATGAATATGGCCCTTAAAACAAAAACAAAGATTAAATGTCTGTCTAACTAAACTAAAATAAGGAAATAAAAGATTCATAAATTAGCAAAGATGTTTTAAGTCATAAAATTCAAGATATTAGTGTTGGGATTTCAAATTTAGAATAGTTTTATTATCAAAAAAATGACCCTAAAAGATAAAAAGAAAGCAAAGAACCTAGCTCAAGCATAGACAGCTCTTAATAGGAAGTGAGTAAAAAAAATAACAGTGTTGTATAAAACTAAAACCAAAATTAACCAGCATCAATTCATTTTAGTAATTGGAATTAGTCTAATTTAAAATTTGAAAGTCAACATGAAAAAGGAAAATAAAAAAGCTAAGACCTCAAAAATGTATAGTCTGATGAGAATAAATGTGATAAATTTTAAGCAATAGATTAAAACAATTAAGATGATGAAACAGACAACATTTATAAGTTAAATATATTTGAGCAATAAAGGCTTATAGTAAAAAATGATATTGATCTCAAATAACAATTTTAAAGCAACATAAAATAAAATTCTTTAGAAAAATAAAAATAAATTGTAAACTACAAAGCAATAGAGTTAGAAAAAATATTTTTAGATAAATTTATGAACTAGAAAAAAGAATTCGAGAACAAAATAACCTAAAAAAAATCTTTGAGCAATGAAAAACTGGAAAATCTTTAACCAAAAATATTAAATTAAAAAGAACAGCAAAAACAAACTAAGTCACAAAAGAATATATAAAATGTACTTAAAAGAGAGCTTGGCTTAGATTTGCCTTCCCCATAGAAAAAGAAAGTGAAAAAACTATAACAAAAAAAAATTTTTAAAGCAAATTCTGATGATGAAGAATAAGAGGAAGAAAAAGATTTCTTACAAGGAAATAACAATTAAGAAACCGAAATAGAAACGAGAATATTAGATAAGCAAGCAAAGAGAGAAAAATTCAATAAAAAGAATATAAATGAAAAATGTAATGAGAGCAAATAATCAGATGAAAGTTTTCAAAATACAAGAGAAAGTAGCAGTGAAAATAGTGAATAAGAATAATAAAATTAGCTTAGGAGATCTAGTAGAGTGAAAAGAGCACCTGTCTCACTTGATAATAATATATTTACTATTTATGAACAGAAGAAATCCTCACTAAAAGAGAAAGATGTGACAAGTAATGAATCCAAATAATCCTCTTCTGATACTAAGCAAATAGAAGAAATAAATCTGTTTTCTTCATCTACAAAAAAATAAAAATAAACAAAAAATAAACCAAATAGCTAGAAATAGAATAAATTTAAGAAATCTAAAGAAAACATTTTCTCCAACGATGAAGAAGATAAAAATATCTATTAAAGTAATGATGAAGACAGTGGATTAAGCGATTACTTCTATTCAAAAAGTAAACCCAAAAAAAAAATTAAATGGGAAGATGATCAAAATTAAGTTAAGTGTGAAAAGAGTTTGAAATTTGATGACCTAGAAAGCTCTGCTGAAGAAGGAAACAAAAATAAAAAAAATATTTAGTAAAAATAAAAAAAAATAAACTATAGAAACCTTGATTAACGAGAAGATGAATCATTATAAGAAGAAAATAGTGTATATAACAATGATTCTTTTTAACTAATGCTAGATTCCTCACTAACAGAATAAGAGGAATTGTAAGACTTAGGATATATCATAGATAAGTTAAATTAATATGAAAATAAGGAAAATTTAGAGTCTAAACAAGTTGAGGAAGACGAAGATATTGAAGATGATATACCAATAGACTTACCTGATTTAACGTCTCATTTTTTTTATGATGAAAAAGAGGAGTAAAGTTAAAGCAAAACAATATTCTAGTTGGAATCTAATATAAATATTTTAGAATAAAAAATTTTCTTTTTAAAGGAAGACTCTAAACTCAAAAAATACTCAATTCTAAATCATTAAAATTTTGAGATGTATTAATAAAAGGAGTTAAAAAGATTAATGAGTAGAAAAGAGATGTTAGAATAACAAATTTAGTAAAAGAAAAAAATAAAGATAGAAAAATATAGACAACAACTGCATTATTTTGATTAAATATTAGATCTGAAGTGCTTACCAAATATCAAAAGTTAAAATTTTTAAAAATGCTTAAAAAACAACATTGATAAGTAAGTCCCTTCTTTTAGGTTGATAAAGTATAAGCTAAGCTAAAACCAAGACTTCTCAAAAGAAATACCTCTTAACTTTTAAATTTGTGATCTCAATTCGAAATTTGAAATTATAGGATTTTCTACACTTACCAAAGTGAATATAAAGCAAAAAGAGCATGCAAATTTAATTCATAACTTTTTTTCCTTTCAAAAATGATTTAAAAGTGAAAATCTTTTTATATTTTTATATACCATGTTAATAATAAATTAATTAATTGTAAATCAATAAATTTTACAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-134.4 L-244.6 L-335.1 S-070.3 S-335.2
S-639.7 S-937.3 S-1261.5 S-1547.7 S-2488.9
C-042.2 C-213,360.8 C-412,448.0 C-616,207.1 C-823,627.3
C-109,215.1 C-124,681.3 C-142,403.7 C-162,929.9 C-183,497.9