Summary
Transcript IDgene_000005243
Gene IDTTHERM_00070770
Length1028 bp
Sequence
ATGAGTTTTACTACAAGTTTTTCTGACATTTTTGATAATCAAAAAGGTGTTTTGCAAACTGGTTATGTCCACAATAACTTTTCAACCTTCTCATTTACTAATTAAATATAGAATTAGTTTAAATTAAAGGCTAAGGTTTATTAGCGCATCGAAAACAATGGAACAACTTCTGTTCATAATAACGGTTTGCTTGAGCTTGATTATAAAAATGATGAGTGGAGATTTTCAAAAAAAATTGATGTAAATAGAAATATATCTATGAGAATTGATAAGCTCCTTTAACAAGAATTTGTGAAAGGACATACAATTTTTGGTAAATTTGATAAAGATTCTGACTCCTAAACTGAATCATAGCACAATCCCTGCATAGGTGTTTATAAAAATTTTGATAAATATGCATACAAGGCAAAATTTAATATAGAAACATTAGTTGCATAACTTAAGGGTAAAGCAGTCTATGATAAGCATAGCAGTGAAGATAAAGAGTAATATGGTACTGGAGTTTCAGCAAGCTTTGATTTCAAATAAAACTTATTTTCTAATGCCAAGACTTTAGTCTATTACAATAGCTTGAATACATCAATGAATATGCAATACTAAATGAAAAGATTATAAAGGGTCGATGACCATGAAGCTTCAAGCAGTTAAGGAGGAGAAATCTACTATACATTCTTGTATTCACTTTACTAAAAGTTAAATGATCATTTAAGTATTGCAGTTGAACTTAATCATGATTCTAATGAGAAAAAATTCGGAATGGTATTTGGTGGAAAATATACAAAATTTGATAATGTAATTTGCCGTGCTAAAATCGATGATAAATTTATCGTTAATTCCTCCTTCGAAATAGACATCAACAAAAATATTAAATTCACAATATCAAATATGATTGATTTGAGTCTAAGAAACAAAAAAGATGCAACAACTACTTCTTCTCATTATAGCTTCCCTATCGGTTTCTAACTTGATATCTAATAGTGAATATTTAATTCAAATAAAGTGGCTATTCATGCAAAAAATTTTATTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,928.2 L-21,978.9 L-31,780.1 S-0952.5 S-3575.5
S-6698.2 S-9621.5 S-12716.3 S-15734.4 S-24804.5
C-0601.8 C-2700.2 C-4493.7 C-6390.3 C-8343.4
C-10284.0 C-12427.5 C-14559.2 C-16511.0 C-18559.8