Summary
Transcript IDgene_000005257
Gene IDTTHERM_00069400
Length1926 bp
Sequence
CTAAGAAAAATATCATCAGAAAAATTAAATAATTAAACAAATAAATAGGATTTAAAAGACAAATATTTAATTTTAAATTACAAGCAAAAGCATTACCTATAAAATTAAAATGTCAGCCCAAGAAATTATTTTAAGAATTCGTCACCCAAAAGGTTTTAGCAGACTTACAGTTAACTCTAAGGATACTGTTAAAATATTAAAAGACAAAATTAGCGCCCTTGCATAATTGCCTGTTTCAGATTTTAAGATATTTTATGATTAAAATTATTCTTCAACTGCTTAGTTACTTTCACCTGATTCTACTTCTCTTAGTTTAATTCCTAAGTTGAAAAATGGTGTTGAATTGTTCCTCAAGGTACAAGCTTAAATGGCAAATCCAACTTTAGAGAAAAAAAGATCCCTAAGTCCTACACTAAAAGCTTAAAATTAATAAAACCTACTCTCAGTTAATTGTAATCACTCCCTCAATCAAAGATGTATTAACTGCCCTCCTTAAAATAACCCTAAAGAAAAAGAAAAAGATGTTAAAATACCTGCTTACGTAAATAAATGTACTCATCCTCCAGGTGGATCTTGTTTGAATTGCATAGACACTTCTAAGAAAGATGAAAAGCTTGAGAAGAAAGAAACTTAAAAATGGCTTTGCTAACATGGACCTAATGGAAAATGTTCTCACTGTATAGATGCAGATTACATTTCAAATATTAAGCACGTATCATTCACTCACTTCTTAGATGAGAAGAAACTTAAATGTAAAGGTGTTCATCCTCCCACTGCAAAATGTCCAAACTGTACTCCTCCTTCTGAACAAAGAATGACTGTTGAATTAAATTGTAAAAACCATGAACCATGGCCTAAGGCTATGTGCAATAATTGTCTTCCACCAAATGTTGTTGTTTATAGATAACCCTATAGACATGTAGATTTCGCTTAGTTTATGAATGTTAGAGAAGTTAGCAACTTTGTATAAGCATGGACATAAAATTCTCATGCAGAATAAAGAGTTGGATATATGTATGGTTATTATGCAGAAGACCCAAATTATAAGGGTGGTGTTAGAGCTATTATTGAAGCCATTTATGAACCTCCTTAGATAGGTGATATCTCTGGATTTTAGATTTTAGAAGATGAAAATGAGACTCTTGTTAACACAATAGCAGAAGCTCTTACTTTAGAAAAAATAGGATGGATTTTCACTACAATTAATCACGATACTTTCTTATCATCTCACGAAGTTCGTATGGCTGCTAGATTTTAAGAATAATATAGAGTACTTCATGAATCTGGCTATCCTTTCTCCACATTTATTACCACAGTTTTGAGAACTGGTAAGGATAACCCAAGTGAAATTAAACCTGAAGTATATATGGTTTCTGATTAAGCATAGGTTTTAGAAAAAAATAATGTATTTGGAGATAGCGAAAGAAGAAAGTTTATGAAAGTCAGAGAATCAAAAGATGAGAGAGATGTTTTGCCTTCTATTATCGTATCTGGTAAATAAGTAAATGAATTTGAACCTGATTTCTTATTAGTAAATGTTGCCCATGGTCATTCTAACCATAATAAATTCTCTATTGTTAAGCATGCTGATTTCCCTGTAGAAAACCGTTAAGAATAAAATCCTAATGAAGTGAAAAAATACTTACAGAAATTCAAAAATTAGAAATCATGGGAGAAATATTCTGATTTCCACTTATTAATCTACTTAGCTAAATTAGTGGATTTAGAAACTACTTTAGTAATTGCTGATGCTGTAGCTAAAGAAAAAGATGTTCCAGAAACCTGTGAAGAATTAATTAGAGGAATAGTTGGTTTTTGATTAATTTGATGAATTATGTTAAAAATTGAATAACTATTTGCTTTAAAATATTTAAATTAATTAATTAATTAGTTTATTTGAGTTTAAAAAATAAAATAAACTAATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,688.1 L-27,019.1 L-36,845.3 S-014,585.0 S-38,022.8
S-67,401.6 S-98,489.3 S-128,582.2 S-158,553.4 S-249,216.0
C-05,377.3 C-24,684.3 C-49,918.7 C-67,535.2 C-87,318.6
C-105,963.2 C-126,618.8 C-148,524.2 C-168,112.7 C-188,045.2