Summary
Transcript IDgene_000005258
Gene IDTTHERM_00069400
Length1974 bp
Sequence
TAGACTATGGTGAATTTCAAACCTAATTAAAACGTATAGCAAGTATCAAATTTAAATTCTTTTTAGAGTTTGAGAAGGTTAAATACAATGAGTAATCTAGGTAAAGGAAATGCAAACGATTTTTAAAATAACCCAAACTTCAACAACTTGAAGTCAATAAGAGAACAAATTCTTCATAGTGATTTAAATTTAAGCGATTTAGGTGATTAAAGCTATTAGTGTGTTCATCATGGAAAGAGAGAGTATTTTCATGAGAATGGAACTATTAAGTAAGAAATAACTGCATTTGATCCTAAATCTATAATAAATTACTATTGTGAAGACTGTAGAGAATTTTGTTGTGAATATTGTATCGCACTAGGCCCTCATAATAATGAATTACACAAGGTAAGCTTTTTAAAAAGCTTTGCTGAAAGATACTACGATTTCATAGATAAATTTTTAAGATCATCAGCTAATTAGAAGTGTTCACAACTGTTTAACAAAATAAAACAAATGAATGAGAGATAAGATTTGATATCTAATTAAGCACAAGTTATAGAAAGAGATGCATACATTGAATTTACTCATATACTCGAAAGACTCAATTTAGCAGAAGGCAATAAAGTTTCTGTATTGTAAAATGATATAGCTAGAATACAAAGAGACATAAATTCTATTGAAGACACAGTTAAGGCTTTTGAAAATTTAGCATCAAGAGAAGATAGACTTCCTTTCTTATTATTCTATAGATCTTTAAATTAGCATGTTATTGAGGCTTTATCTTTGCATGTTAAATAGGAAATCACACAAACACCTTATGATCTGCCTAGAGAAATCTCATCAATTAAAGTATAAATGGAAAATTTTAAACCAAACGACGAGATTCTAAAATTTAAAGATATCATTATTTGGGACTTAATAGAAGAAAAAAACAAACATTTAGAATCAATAAGAGTATAGTAATCAGAATCTTATCAATCTAAATTAGAATTATGGACAGAATTGGCAAAAAAAACATTTGAAGAATTTGAATCGATATAGCTTATATGCCACTATTGTGGTGAATTAATAAATGATGATATTATTAATTAGGATTGTTTTAATAACTAGATTTTTAAAGATCGTGATCGTTCAATTCCAATCACTGTATATTCTGATGAAGTAATGGAAAGAGGTATATATGGATCTAAGAGACATTTTTGGGTAAAGCCTCGTTTAAGAGATCGCTAGATTAAGCTTGGTTAACTCCCTAATATCTAAGCAGGAAAGAGAAAAGGAATAAACAGATCAGTAGCTTATTATAATTACATGAAACTTTATTAGTTGATGTTTGCACTTATAAAGAAGAAGAAGGCAGAAAAAGGAGTTGACTTAGAATAGATTTTTTAGGGATATGACAAAGAAAGATCAGGATATTGCTCAATTATACAGTTTTAATATGTTCTTAATACTGTCTTAGATCTAGAAATAGATTATGTAGAGAGGGCTACAGAATTTTTAGGAACTACTTAAAAAGAAGTAAACAGATTAAATGGTATTCCTGATGACGAGCCGTAAGAAGAAAAAAATTATGGAGAAAATCCATTTGCACCATCGTTTTTAATTAGAGAGCCTGTTCCTGAAAAACCAACATTAGTTAATTATATAGTGTTCTTAAAAATTATGTAAAATCCTGCATATTTAGAATACGAATCTTTTAAAGTAATTGACTACGCTCATATAAAATTGCATGGCTAGAATTACTTCATTTAATTAGATGATGATCTTTATAAGTAATGCAGATTAGATGGAAATACAAAAGTAAGCCAATAAAATGCAAAAGGGGATTTTAACTCTACCCTCAGAGGAGGATATAATGCAGGAAAATTTTCTTCAAGCAGTTATGGCAGAACAGATTTCAGCAGCACTTTAAGAAAATGATGATATTTTTGTTTAGATTAAATTCTTTAAAGTATAATTAAAATATTTTGTAAATATTTGTATATAAAAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1476.7 L-2450.0 L-3399.4 S-0574.0 S-3555.7
S-6403.2 S-9447.2 S-12569.2 S-15643.7 S-24579.9
C-0396.5 C-22,469.6 C-4917.6 C-6562.6 C-81,019.5
C-10780.0 C-12825.1 C-14765.9 C-16539.8 C-18666.7