Summary
Transcript IDgene_000005387
Gene IDTTHERM_00439030
Length3696 bp
Sequence
ACTAATAAATATTTAGAAACAAAGAGATAAATAAATAAAATACACACACATAATTACTATAGCTAGTAGCTAATCTTAGTTTATAAAATTAAAAGGAATCTAAAACATTTTACTTAAAAAAAGGAATTTAAAAAGTTTTATTATTGAATAAACGCTTCACCCCTACTAGCTGCATACAAATTAGGCTATATATAGGTTATATTTATTTCAATCGAGTAAAAACCCAACACATTCACATAAATGGAAATTACTGAACTTGCTTAATAAGAGATTAAAAAAATTGTCTCTTCTTTAAATTATCCGCAACAACTATGCGATCTAGCATTCTTTTAATTTCAAGATTACATGAAAAAGACAAAATACTTCGTAAGTGAAGAAAAGCTAAATACTATTTTGAAATGTGCTTTGCTCATTGTTATAAAAACTTTAAAACATTAATTCAATTAAAATAGCTTCCCTACTTCTCTGTCTTATATTATCTAAGACCAAACTGAGAAGATGGATGAAATTATGATAACACTAAAGGAATGGACAACTTTTGGATAGATTTACGAAGAAGCAAGATAAGAAATAGTGCAAATAGTAGAATCTTTCTCATATATGCTTACTATATTTAATAAATTTGAAAAAGTGTTTCGCCACTTCTAATTTGAAGAGCAAAATATGCAATAAAAAAAATACAATAAATAACTAAAGCATATTTGTTGGCTTTTATTAATAATCACTAAATAATAGCACGAAACTGTAATAGAGACCACTTTGCTTATTCCAGCTGTATTCCAATTTCTATTGAAAGGTGCTTAGCGCTTCACTACTGGCTAATTCTTGGAATAAACTAAAGGAAATGAAAAATAAGAACTTTTGAAGCTTTTCCAAGTTTAAGACATTGAATAATATGAAGCTACAGTTAGCAGATTTGTCAATGCTTTAAAACCAATTTGCGACTCAAATTTATTATAGTGTGATGGTGATATATTCTAAATATTCGGACCAAAATTAATTGAATCTAATATAGAAAATTTAAGCAGTTATTATACAAGTAATATAATGATTGATTTGGATCTGCAATATTTTGTTATTGATAAGAAAAGAGCTTGCAATCCAAATAATTTTACTCCTTTCAGTAGATAAGGAGTCAATAATAAGTAAGCAGCACCTTTTCCATTAGAAAAATATGGACTTTTAAATACATCAAATAGCTCTATTTCTTCTTCAAGCAACTCATCTTCTTCAGTTGCAAAAAAGTAAGAGTAAACAAATCCTTAAACTCATTTAGATAGTAAAGCTAAATATGCTTCATAAAGGCTTCTTAATTATGATATGGTAGAATCATTAAGTGAATCTAAATCAATATAAGATTTCAAAGTCTCAAATCTTAATGTTACTTCCCCTTACATAGTTAAATAGTAATCATCACTGAGTAGAGCAGCTGCTACACCAACAAGTAATGCTATGGAAATGTATAACTGGCTACTTTCTAGAAAAAATATTAACAGTTGCTCAACAGGAAGCATTGCTTTAGAACTGAAAAAGAAAATTGAAAATTTGGACGTTTGGCTAGATGATTAAATAAACAAATTAATTGAATTCGAAAATAAGTAGCAATAAGAGTAAAGAAAGGAATAGATTTAATCATTATTTTATAGAATCTTAAACGAGTATTACAATGAGGAGAAATCTGTTAATTTAAATGTTTAAAAAGGTGTTTTAGTTTGTGCTTGCGAATCTGTTTACTTTATCCTTAATGTATCCTATATAGACTTTTAAAAGTTAGTTCATTTTATTGATATTAATTGGTTTGAGTTATGGAAGATTATGGATTTCATCATGAGATTAGATCAAACTATGCCTGTTTCTTTAAAGGCTCACATTCTAGACTTAGAGGTAAAGATAGTATCTTATTATTCTTGGAGATAAGATTCTTAGCTTTTATAGTTTGTAAAAGCTTATATTTAAGATACAGAATAAGCTAAAAAGCTACTTGATGATCGCTAATAAGGCAGTGCTATTGAGAAATTCTTCAGGAGAGTCTTACACTAGTGTGCTTATACTATTAATCAAGTTTGTAGTGCATTAAAATTAAATGACAAAATAAGTGAAGCTGTATGGAGGATTATGAAACATATTTTAGCCAATTAATCAGATATCCTTCTTGGAAGACATATTGATCAATTAGTGATTTGCTCTATCTATATCATGTGCAAGCTTTTTAAATCTGAAACTATTTTCAAATAGATCTTAAATAAATATGAAGAATTAAATTCTCATAATAAGGCTATGATGAGAGAGCTAATTTATGCAATGCCTATTGCTCCTAACAAGCTAGATACTATAGTATCATACTATAATAATGTTTACCTAGGCTTTGTTAAAGAAGCTGCCGTTTAAATTTATAAAAGTTTAAAGGATGAGTTTTAAATTTCTGAAATATCCTCTCCTTAAAGCAATCATAAATAAAGTAAGAGTGAAATAATTACAAGGAATCCTGCTATAGCAACTCCTATATTTACTTCACCTTTGAAATCAATTCTACCAAATGACGTTCGTAAATCAATTAGTAAATTACCAAGTCATATGACACCTCAAACACAAATGTTGTACGCATACAATGAATCTCCTTTACTAAAAGAAAATCTTGTAAGTAATCAAAACCTCAGAAGTGTTTATTCAAAGAAAATGATTAATTTTGATGCTGAAATAAACCCTACATAAAATCAATAAAACCCCTAATACTAATTTACTAGTAATGCCCAACAATAACTTTCAACAGTAATATAAAATGTAGCTAAAAATGGATAATCATACTATGGTTTCTAAGCCTAAAACACATCAACTTTCTCAAAATATATTAAACCAAATATGGATAGCATAACAGAATCTTAACAAGAAAATCAAACATCCAACTTCATTCCTCATAAATTTAAAAAAGCAACAGAACAATAGTAATAATAACAATAATTACCTTTAATGAAGCGTAATCTGTTTTCTCAAAGGTAGAATACTGAAGGTGATTAATCAGACGTGACCAATAATTCTATAATATCATGTTAGAGTACACCTAGAGTGATATCAAACAACTAAAATAATTCTAATATTCAAATTTAACAACCTCCTTAATCATAGAATCCTGATCATTAATAAAACAACTTGAGTTTCTTAAAAAATTTTACAAAGCAATCATAGTATTAATATAATTAGATAATATCCCCTACCAAACAACCACAATAATTAACTTCCCCTTTCAACTAATAAAAACTTGTATCACCAAATAGTCATTCATAATTACCTTTACAATAAATACCTTAATAAAAAATAACCTCATGGAAAAACCAAACAAAGAATGTCTAAACTTAAATAAAATAATAAACAAATATCCTAGAAGCTTTTAACAAGAAAAAAGTTTGACTTTAAAAACGAACAAACAAACAAACACTAAAATATTTAGTGCAATAGTTAGTTAGTTAGTTATTAAATTTTTATCTTAATATTTTGAATCTAAAATTTGCTAATTTTGTAATACAAATTTTTAAATAAAGTGAAGTTAAATTTTACCACAAATAATATCAATAAAACTAGAACAAACCAATAAAGGTGTAATTAATTAAATAAAAATAAAGTATATCATATTTATTGAGCATTAACTAAGATCATCTAAATTTATAAGTAAAGAACAATAAAAAATAAACTCTGTATTGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1996.1 L-2883.3 L-3924.8 S-0144.2 S-3246.4
S-677.1 S-981.2 S-1283.5 S-1577.6 S-2491.8
C-038.6 C-21,323.8 C-49,602.6 C-66,969.9 C-82,465.7
C-10847.4 C-121,127.0 C-141,370.8 C-16871.4 C-18265.6