Summary
Transcript IDgene_000005516
Gene IDTTHERM_00464930
Length711 bp
Sequence
AAAAAATAAAGATTATTAAAAAAAGCTAATTAGATTTTAAAGAGGATAAGTAAGATGAATACAAAATCATTCGAAGTTTTGATCCATTCTTAATATGCATTTGATGTTTGCAGAGAGCAAGTTTACAATTTCGAGGATTGTAGATAAACTGATACTCCTCTTCCCAAGGATCCCATTCATTGTAAAGCTTAAGCCAAAGAAGTCCTTTCATGTTACAAAGAAGCTGAAAAGATGGATCCTATTTGTTTGAGTTCTTTCAACGATTCTCGTGAATGCATGTTCAAGTCTGATGGCAATTTGTATAACTGTAAAACATGGATTAATTAATACGTTACCTGCTAAAAGAACCCTGCTGCTTTCGCTGAGTTCCTCGAAGCATCTACTGCCGAATAACTCAAATCTAAGAAGTTCGATTTCGTTAAAAACAGAGGTCATAGTGATAAATATTTGTGATTACTTAAGCTTAGCAAATTATAAGTAAGTAGCTCATTTTAACTAAAAACGAGTTTTAATTCTGACACTTTCTTAAGAGATTATTGTATTTTATCAAAGTTAACTGATATAATTAATAGGTTTCAATCTCATATAAACAAATATATTAAGTTAATCTTTGGTTATCAGTTATTTATGCATAATTATGTCTCTTTGATGTTTGTCGACTTTTTACTCAATTATTCTACCTATAAAAACACACTTTCATTTCAAATAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-19,480.2 L-210,153.7 L-311,000.0 S-05,575.7 S-34,003.7
S-62,549.9 S-92,219.5 S-122,473.7 S-152,216.8 S-241,829.9
C-01,542.9 C-22,509.7 C-42,281.0 C-62,837.6 C-82,112.5
C-102,306.7 C-122,294.2 C-141,931.6 C-161,979.2 C-181,696.0