Summary
Transcript IDgene_000005569
Gene IDTTHERM_00469100
Length1394 bp
Sequence
TATCTATTAATAATAAATAAATAAAGATATTGATTTTATATAAAACTAAAAATTTAAAATATAAAGAAATGGCTTCAACTGATAATCCAGTAGTTTAAAATTACCTTAGAGTTAAGCGTGAACATGAGAAGATGGAAATCGATTTAAAAAAGCAAAGATTCAACTTACGTGACTTGAATAAGCAATTAGATAAAACTGATGATTAGCTTAAGGCTATCTAAAGTGTAGGATAACCAATTGGTGAAGTTTTAAAGCAAATTAATGAAGAAAAATACATTGTTAAATCATCAAGTGGCCCTAGATACGTAGTTGGTGTTAAATCTAAAATTAATAGAGAAAAGCTTGTTATTGGAGCTAGAGTAGCATTAGATTAGAATACTTATACTATTGTTAGAATCTTGCCTAGAGAAGTAGATCCTATGGTATATCATATGTTACATGAAGATCCAGGTAAAGTTACCTTTGACGATGTCGGTGGTTTAGATGACTAAATTAGAACTCTTAGAGAAACTATTGAGTTACCAATCACAAATCCAGAATTGTTTAGAAGAGTAGGTGTTAAGCCTCCTAAAGGTTGTTTGATGTATGGACCTCCTGGTACTGGTAAAACTTTAATTGCAAGAGCTCTTGCCAATAATGTTGATGCAAAATTCTTAAAGGTTGTAGCATCAGGTATAGTAGATAAATATATTGGTGAATCTGCAAGAGTTATTCGTGAAATGTTCGCTTTTGCAAGAGAGCACGAACCATGCATTATATTTATGGATGAAATCGATGCTATTGGTGGTCGTAGATTTTCAGAAGGTTCTTCTGCTGATAGAGAAATCCAAAGAACTTTGATGGAACTTCTAAATCAAATTGATGGTTTTGATGATTTAAAGAGAGTCAAGATTGTTATGGCCACAAATAGACCCGATGTGCTTGATCCTGCACTTATGAGACCAGGTCGTTTAGATAGAAAAGTAGAAATTCCCTTACCTAATGAATAGGCCCGTGCAAAAATTTTAGGCATTCATATGAAAACTATTACTATATTAGGTGAAGTAACTTATATTGAAGAACTTGCCAAGCTTACAGAAGATTTCAATGGAGCTGATTTACGTAACGTATGTACAGAAGCAGGTATGTTTGCTATTAGAGCTGGTAGAGATTATGTCATTTAAGAAGATTTCTTCAAGGCTGCTAGAAAGATAAAAGAATCTAAAAAATTAGAATCTAAGTTAGATTACAGCAAAGTTTGATCAATCTAAAAAATGCAAAAAAATATACAAAACACATAAATAAAAAATTTGGAAATATTAAATTAATTGTAATTAGATATAATCATTCTACTTTATTTTTTATATTTTTCTCCTTTAAGATTTTTCTTAATAATCTAACTAAATTAATATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-118,329.3 L-218,921.5 L-316,587.8 S-026,182.1 S-317,254.2
S-614,393.9 S-913,175.2 S-1216,240.2 S-1516,742.7 S-2416,236.8
C-08,464.0 C-23,191.8 C-47,892.2 C-67,521.7 C-812,369.6
C-1013,708.1 C-1213,140.9 C-1410,260.7 C-1611,338.1 C-1811,205.1