Summary
Transcript IDgene_000005740
Gene IDTTHERM_00459230TTHERM_00459240
Length2148 bp
Sequence
GCAAATATATATAGTTGAAGAAAAAAATTAAAATAAAATAAAAGCAAGTATTAAGAAGGAAGGATTAGTAAAATGGACGTTTTAAAAAAGTATGCTCAAGATGTAAAAACAAAAGTTCTTAACTTGAATAGATCACCACTTGAAAAATTATTGCATGAAGTTACTTCCAACGATAATTGGGGAGTTAACCCTAAATTATTGAGATAAGTCTCAGATGAAAGCTACCATTTTGAAAATAGAGAAGTGATACTGAATTTTATTTTTCACAGGCTAAGTAATAAGACGAAGAATTGGCGCAAAATTTTAAAAACTTTAGAATTGATAGAGTACCTAATTAAAAATGGATTATATGACCTATGTAGTGATTTTAGGCGAGAAATAGTTCATATCACGACTCATTGTGATTTTTAAATGCTTGAAAAAGGAGTAGATAGAGGACTCTCTATTAGGAATAAAGCTTAAAAAATAGTTTAGCTTTTATCAGATGATGGAGATCTTTAATTTGAAAGAGATTAAGCTAAGTAACTTTATTAGAGATCTATGAACATGCAAGGTTTTGGCTCTGATAAACCGATATCTGTATAAAGCCAAAATTATAATAAATAACCAAAATCGAATTCTGTTTATGAAAACGGTGAAGATGAAGACGATTAATAAGACGATGTATATAAATATAGTAGAAATAAAGATAGTGATGATGAAGATGATAATGGTAAAAATAAAATCAAAGGAAATGGTAATAGTTAAAAAGATAAGAAAAATAATAATTATTATGAGGAAGAGGAGGAAGAGTAATCTGGATCTTAAAATTATTCACGTTCAAAATAACAAAGTGCTCCTTAAAAATAATTAAATAATAAAGAAATTCCAACAAAAGGATAGTCAGATGATTTCTGGTAGTAGTAGTGGGAGTGGGGATTTACAGCAAACAGTAATAAGATATAGTAGGATTAAAGTTAAAAATAATTATGGAATTAAAATGGATATACATAACAACCTAATTAATAGAAAAATTGGTAACAATCAAGCCAAAACTAATAGTAAAGCCAGTAGTAGATTTAGTAGCAATAAAGAAGAAATGAAGAGGAAAAGCAAAGACAAGAAAAAATGCAGCAATAACAGCAAGAATTTTAAAGAAATTAATAAAAAAATTTCTAGCAATAAGCTCAACAATAACAATAACAATAGCAATAGCAATAGGCTTAATAATAAAAGAAAAAAGAGACAGAAATCAATCTTCTTGACTTAGACATAGATACTACTCCATAAAATGGATAGCAAAATCAGTAGATAATCTTTTAGCAATATTAGCAGCAAATTCCTCAAGTTAATTAATAAAATATAGGATTTTCTCAAAATCAAAATATATTAAATCAATATTAGCAAAATTAATCACAGCCATCTCCTATCTAAAATCAGATAGATTTCAATCAAAACAAAATGGAATAAAAATAAAATGACAACAACGAAGATTATAAAAATTTTAGTAAAAATGAATAAATGCTGATAGATCTAAATGAAATTAAGAATGAATAAAAGAAAGAAGAGTAGAAAACTCAATTTGATAACTTATTTTAATTTGGGAACAACAATTTTTCTAATTAAAATAGTAATTAATAAAATTTGTAGGATAATAGCAAGAGAGACTATAGTGCTTTAAATGCACTTAGTGCATACTAACAATAAGTGAATTAATATTAAACATATGGAGGTAGTATGTATGGTTCCAACGTCTCAGGTACATTTTACAACTAACAATACATGTATTAGCAACCTCCATAAATGTTTTAATCTTAGTCAACATATTAATATTAATCTTAACAAAATTTCCCGTATTAAATGAATCAAAAAGGTCAATTCTAACAATGAAAAATAGTTAAAATATTATGAATTTATAATTTGAAGCTTATTATTTTCAAAATACCACTACAATTATAATTTAATAAAACTTGTATAATACATCTTATAAACCATTTATTTATATTATTTTTTATTCATTTAACTAACTTTCTCAAAGAATATTCTTTACTCTATTTTTTATAAAATCAACCAGTAGAAGGCTTTTTATCACATTCAACATCTCCTACTCCTCTGTCGCTAACCATAATATCAACTTCTTTATCTTACAAATAAGGTGAATCAACCAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1561.5 L-2585.7 L-3449.7 S-01,961.8 S-3776.1
S-6785.4 S-9868.9 S-12871.3 S-15992.4 S-24929.5
C-0447.0 C-2444.0 C-4434.3 C-6509.2 C-8263.2
C-10474.2 C-12459.5 C-14463.6 C-16447.1 C-18446.9