Summary
Transcript IDgene_000005755
Gene IDTTHERM_00398070
Length2384 bp
Sequence
AAATTCATAGCTAAATTAATAAAAAAGATAAATAAAAATGTTAGAGAGCACAGCCACACCTATGTTATTAAAGAACCGAAATAGACCTGGGTTCAGTATGTTAAATTAAATTAAAATGAATGAAAATTCATTGGATCATTAAAGCAGGTCAAACAATCACGCTTTTGAAATCAATAAAGGAAATAGTCTTTAATACTTAAAAGAATTGAGTGCTTAAAAAAAAATAGACTTTGCGAATTTAAACAAAAAAGAAGGAGGAGATAAAAGGGTTACTTGGAGTCCTTTTATTACTTAGAATAACTTAATATAAAATAACAGAGATCATAAAAGCGAGGGCATTTCAGATCTCATGCAAAGTAATAAAGAAAACTATCAAAATATTATCAATAATAACAACAAAAATAATGTACAAGAATTTCTTTAGTCTGCTCTAAAATAAAAATAAAAGAACAAAGTTACGTTCAAAGATGACATTTTAGAAACAGAAAAAGCTATTTAAAATAAATTTTTAGCAACTCAAAATTAGCAACAAAATAAATAAAAATCTGCTTCTTAAAGTTATCCAGAACTATTTAAAAATTACGCACAAAAACTTGACAGATATTAACACTATTAGCAACCCCAATATTAAAATTAAGAGATTTTTCATGAAAATATTGAAAAATCCTACATCTAAAACCATGATCAAATCCCAGAATGGAGCTCTGATGCCCTCTAAATAGCTAAATCAGCAATTAGAAAGAATTAAATTTTTACTAAGGCAAAGTTTATCAGTTTGAGCTTTGGATTTGCAGTAGCTATCATATTATTATGCAGCTTATTTATTAGCTTTAAAACTCTAAAGCTCTTCAAGATATTTGTTCTTATAGGAGCTGTTATTAGTCTAAGAACATTAGTTTATGAAGATTAATTTCAGAATGTCATGAAAGATCTAGGCTTAAAAGATTTAGGAATATTGGCCTCGATAGCTATGATTGAATTCTTTTGCATGATGGGATTTGCTTCTGAAATATTTGCTGCCATACTTCCATCACACTTACAACTAGAAATATTTTGGGTTGTCCCAAGTGGGTTCTTGGCTTTAATGGAAACAATTATTTATTGGAGAAAGAGCTAGCAAAACAAAATAAATGAAGAATTTCTGAATATAAAATGCAACACATTTGAGATTCTTAAGGATAGTCTAAAATAATATTTCTAAAGTTTCCAGTTTTTAAAGGATGCTGTGACTCAAGCTATTTCAAGTGCTCTGATTGTTACATGCTGCTATTATTCTAAGATATATTATCACGAATAACAATTAATGTAAAATCAATACTTTAAAAAGGAAATGTTATTTAATCTAAACACCTTCCCTGAAATTCTACTTGATGACTATTACATCTACATTATATGCATATCAATTCTCTGTAAAATCATCGTATAGTTTTCTTTGAATTTTAATTATGAACTTATGAGATATTCTGTAGTCAGCTATTTGGGTAACTATATATGCTTTCAACCTCTATATACAATCGTCTTTAAATATCCTATTGCTTTTTCTGACTTTATTCAACATGAAGCAATGAAATACTGGTATGCCTACTAGACAGTTCCGTTATCATAGGTGATAGAAAGAACTCAATTTTCTAAAAATTTAACTGAAAATGAAAACAAAGTTTTAGATACTATTTTCGAGTTTATTTCTAAAGAAATGAATAATACTTTGATTGCTTTAGCTTCAAATGACCAAGAAAGCTTTTAAAAAAAGAGAGATATCACAAGTTTCTTCATTAAAAATAGGAAAATATAAACTTTATTAAAAAAACAAAGATTCCTTTAATCTATTTTGAAATTCACTCTAATGATCATTTCAAATAGTGCAAAAGTGTTTAACTTAAAAGTAGTTGATTTTATATAAACTACTTCTTCCACTCTGGATTAACTCATTTAGCTCTTTGAAAAGCAAGGAAATTATTTCACAGCAGAGATAGCAGATATAATTATTTTAAAGAAAGAAGTTGTTTCGAATATTCAATATATCTACACTAAAATGAATAGTACAGTTAAGAGTTAGAATCTCAGTGCAATAGCATTGTCAATTATGATAGACTCAAATCATATCTATAACGAATATGACCTTGATTCAAAGTTTGTTTGCTGATAAAAAATCTTTAAATGCTCATTTGCCATTCTTAATTAAATTAGAATTAAAAAAATTTAATCTACCCTATATATATAAAATGATGTTTCAAAATAAGATACTTACTTATATAATTTAAATTTAGAGTCTGCCTAGTTTTCTAATAAAATATGGCTTTTATCTTCAAAATATATTTAATTTTTTATGTATCTAAGATATTAGTTTTGCATAGTCTGTTTATTTCCCAAAGATTAATACTTCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1698.5 L-2786.7 L-3559.2 S-093.2 S-3335.4
S-6181.9 S-9307.8 S-12391.6 S-15341.5 S-24398.7
C-057.1 C-27,357.5 C-410,769.1 C-611,732.2 C-83,901.5
C-101,764.0 C-121,452.2 C-142,060.9 C-161,503.5 C-18709.4