Summary
Transcript IDgene_000005821
Gene IDTTHERM_00408780
Length3272 bp
Sequence
ATGACTACGTAAATGAGAGAAATCGAATTTATTAGTAGATATACAAGAATTAAAATACTGAAAATAAAGACAGTACTTCGATAAACAGGCCTAGTGCGAGATAATATAATATTGTTAATCTAAATAAGATTAACTTAAGTAATGAAAGGTACTGCGAAATTGAAGCTTATCTTGAAAATTCATAGACAGTTCCAACTTAATAAAACCACTCTAATGCAAATGCTATCTTACCCATTTAGCAGTAGCAGAAAAACCATTCAGTGATTTAACAAGTGATTAAAAAATAGCTATAAGGTGGTTAAAGAATAGTTAAATTCAATAAGAAGAGAAGAGAAATAAAACCTTCCAATCTTTTAGGTGGTGATTATTTTATGTTTTTGGATGCAAAAAGGTAAGGCCACTTGAAATCTCTTAAAGACTGTGATGAAGATGTTCTCTATAGGATTTGGCAGCTTCAAGAAAAAGGAATTGTTGTTAATGAATCGGAATTAATGGCAGTATCATGTGGAGAGTCTATACAGTTGGTCACTTAAAAATAACATGCCTTCTAGAGATAACCTCATTACAATAAAAGAGTTAACGTTCAGTCATTGATTGGCTAAAATACCATATCTAAGAGTGGTATAGATGAAACTCAAATGAATTTGTCAATATCTCCTTCGAGTAATGTGGTTTCTTACCCAACTTAATAATATTATTCTGCTAACTACTAATATTAAAATTCTAATAATGCTGATTAGATTATGATTGATGATTAGTTATCAAATAAAAAGTAGATTGAACAAAATTTAATGATCTCTAGTCTTAATTATAACTAAAAAGATTTTAAAAATAATAATGAATACAGGCTTGTCAGAGCAAAAGATGATTATGATAAAGAAAGCATATAGCAAATGTTTTAACCTTTTAATTCACCCACTAACAGGCCAATGAGCAGTTCGATACAAAATAAGAGGATTGTAAATGGGCTTCCTCTCGTTTCAGGGAATTAAATTTTGACTAATTATAATCAGCTGAGATACATGAATAACATCTAAAAGACATAAAATTAAAAAAATGAACCTCCAAAGAAAATTTCTTATAATTTAGGAATTATTCAGTAGGCTCTTAATGAAGGTACTTAGCCCTCTGCTACAATAACATAAAAAATGATAATAAAACATACTCCTAGGATAAATTCTCGACCTGTTTCGAATTATGAGCAAACTGCAAGTGGAATCGCAGTTGCTTAAAATACAATCAGCTAAAATAATCAATAAAATGATAAATAATTTAAAAGAAAAAGCATTAAAAACACAAATAATTCTCCGAAAAACTAAGTTGTTTCAACTAAATAGCAGATACTATAATAAAAAATGGAAAATTATAGAGATTTCATAAATATCCTCAATTACTCTAACAACTTAATTATTCCTTACAACTTATCAAATCCTAATCCACCTTTATACAAAGTATATATTGGATTGGGTAATAATGGAATTTTAGTTAGATAGATTTTTAAATCAAGGTGGTGGTGGTAGCTAGTCGAAAGCCATGATGACTGGCCTGATTGCTAATTTTTGTGGATGTAGTGGAGAAGGAAAGAGTATACAAAGTATATGAAGTCTCTTCCACAGCTCACATATGAAAAATAGCTAATCAAGAATGTTGAAAACAAAGGAGAGGATGAAAGTAAACCTACTTTAAAAAAGAAGATGACAATTGAGCAGTCCAAGAAAAAAGGAGAATCTTATTAAAAACTGGTTTAAAAGCTTATTAATGAATCAGATTTTGATTCTTTGGAGAATTATTTAATGTAAAATAAGAAAATATTTGCACCTCCATTCATATCTAAAGATTTTTGTAGCGAGAAATACTGTGAAGAGCAAAGTAAAAATAGAACTTTTACAAAATTAAAAGATCCCATAAATTATAAGCTTCATAATCATGTTTAAAATAACTTTCACATTTGCAATAAAAAAGCATTATTCTATAATATGAGATAATATTATGAATGTATATAAAAAAATCCATTTGATTACATTCCTCTAACATTTCATATTAAGGAGGGTACGAGTGATCAAGAATGGGAGAAGTTTTTAACTTTCTATAATTAAATTGAAGGATAAATGCAAGAAAATGAGAAGCTTAGGTAGAAAATAGATGCTGAGAAGCTCAATATTGAAAAGCCTAAATAAATTAAGAATGTTTGGATAATCAAGCCAGGTGAGGCTACAAACAGGGGAAATGGAATCCAAGTTGCATCAGATTTGTAGTCTATATAAAATATAGTTAACACTAAAGAAATGCATAATAATGGCAAGAAAAAAACATTTATCATACAGAAATACCTTGAAAAACCTCTGCTATACAACAAGAGAAAGTTTGATATTAGATGCTATATGCTCATAACAACCTATAACGGTATCATAAAAGGATATTGGTATCAAGAAGGATATATAAGAACTAGTTCAAAAGAATTTACTTTAAGAAATCTAGATAACAAATTTATTCATTTGACTAACGACGCAATTCAAAAAAAAGGGGAAGAATTCGGAAAATTTGAAATTGGAAATAAACTTTCTTTTAATGAATTTTAGAGGTATATGGATACTATAAACAGTTCTAGTTAAGTTAAATATAACTTTATGGAGAAAACCTATCAAGATATGAAAGGTGTTGCAACAGATTGTGTCAAAGCAATTTTCAAGAAGCTTGAGCCTTAAAAAAAATAATTCAGTTTTGAACTATTTGGTTTAGATTTTATGATTGACGATAGCTATAAGACATGGCTGATTGAAGTAAATACAAATCCTTGTTTAGAAACCAGCTGCCCACTTCTAGCTAGAATCATATCCACTCTTGTTGAAAATGTATTTAAAGTTGCAGTTGATCCAATCTTCCCCCCTCCTAATTTCCCTAAGAGTAAAAAGCACTTAATCCCAGAAAATATTTTTGAGTCTAATAAATTTGAATTAATATTCGATGAACTTCAAGACGCTTAATAACTCTCTACCCTTCCTTCTAAAAGTGATTATGATGACTTTTTAGAAGAAGACTGTGAAGAAGAAGAACAGCTACTAGCAGAAGAAGAAAGTGAGTGAAAGGATTTTCAATTATCTGTAAAAATGTTCTATTTAACAAAATAAATTGAGAAAAATTAAAAATAAACTTATTCAAAAAATATAATTTATTTTACTAATATAAAATTTAAAAACAATATTTAAAATGTTATCATTTTAATAATACTTACTATACAAATTATATAAAAAACTGCCATTATTCTACTAGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1600.4 L-2624.2 L-3769.6 S-01,117.6 S-31,237.0
S-61,107.2 S-91,539.6 S-121,323.9 S-151,546.6 S-241,369.2
C-01,547.3 C-2992.4 C-44,555.9 C-63,252.1 C-82,650.3
C-102,201.5 C-122,367.1 C-141,979.1 C-161,583.1 C-181,830.8