Summary
Transcript IDgene_000005908
Gene IDTTHERM_00497120
Length1424 bp
Sequence
ATTAATTCTAATAAAAGTTTATTCAGAATAGACTATTTTAAATTTAAAGAATGATTGGATTATTTGGTAAAAACATTTTAAAGTTTGGTAGAGTCTAAGCACTTAATACTGGAAAATACAGCGCATTAAGCTTAATGAACACTAGCTTAAACAAAAATATTCCCAGAAATTATATAAGAATGACAAAATAAGATGCTGTATAAATTCCTTCTGTTGAAGAAGCAACAAAATACTAACAGGATTTTAAGCTTGATGAAACTGTTACAAACCCTGTCCATGATTTAGTTAAACCTGGAAAAGAAAAATTAATAGGTTCATGGCTATTATTGACTGCTGCAGGTGTTTTTGGAATGATAGTTTTAGGTGGATACACTCGTCTTACCTAATCTGGTCTTTCTATGACTAAATGGAAACCAATTGATCACAAGCTTCCCTCTACATAAGAAGAATGGGAAAAAGAATTTGATAATTATAAAAAATATCCTGAATATTAACTTGTTAACAAAAATATGGATTTAAATGGATTTAAGAAAATATTTTTTGTTGAATGGGCTCACAGATTATGGGGCTCCTCTTTAGGAATCTTGTTTGGTGTTCCATTGTTAGGATTTGCTGCCTTAGGATGGTTAAAAAAGCCCATGTTTTTCAGATTAACAGCTATGCTTGGTTTGGGAGGTTTACAAGGATTAATTGGCTGGTGGATGGTCAAGAGTGGCTTTGAATAAAAGCCTGATTACTAAACTAAGCCAAGAGTTTCAGTTTATAGATTATTCACTCATTTGAATATGGCCATAGTTCTTTATGGAGCATTATTATGGAATGGTTTAACTTTAATTAGAAAACCTTAATAATAAGCACTTTAGCTCTCTCACTTAGCTGGTACTAAGACAATGAGAGGCTTAGGTATTGGTTTATTACATTTCGTAGCTTTGAATATTATGTCTGGAGCTATCGTAGCAGGAATAGATGCTGGAAAAGGTTTTAACACTTGGCCTGACATGAATGGCTAAATGATTCCTGATGGTTTGATGAAAAGAGATCCTTGGTACTTGAATTTCTTTGAAAATAGAGTTTTAGTCTAATTTAACCATAGAAATTGTGCTTATTTGACTGCAAGTTGGACAGGATACATGCTTTACAAAAGTTTATCCCTTAATTTAGCTAAGCATCAAAGATTCTAAATTGGTTTACTCTCATTCTTTATTTTATACTAAATTGCTTCTGGTATAACAGTATTATTACACGGAGCACCTCCAAAAGAATCTTCAGGCCATTAAGCAACAGCTTTGATGACTGTAACTGTTGCCCTTCTTACATGTCATTCATTTAGAAAGCCTTCAAAGCAATATTTAAATTACGTTCAAAAGTTTATTTAATCATAAAAAACTATTTGAGCATTTTGACTAACCTTGCTAATTTTCAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,103.6 L-26,076.1 L-36,964.2 S-02,011.0 S-3502.9
S-6269.4 S-9239.6 S-12207.0 S-15318.0 S-24134.6
C-0126.9 C-2277.9 C-4237.5 C-6176.4 C-8244.8
C-10153.4 C-1296.6 C-1490.8 C-1690.0 C-1858.0