Summary
Transcript IDgene_000006114
Gene IDTTHERM_00522820
Length1803 bp
Sequence
TTTGTAAAAAAAAAATAAAATTAATTAATTAAATTTAAATATAAAAAAATTAAGAAAATGGATAAAGACTCAACCTTCTCATCAGAGAAGTCTTTGATTGATAATGTATAAGTGAAGATTGATGAATTCAAAAAGTAGCAAGGACATCTTGATAGATATCATGAAAAATATAGATTAGCTAAAAAGCTTATTAAGGAATGGGGTAATTTACTTAAAAAGACTAAACAAGGAGCTTAGAAAATAGTTGAAACTTAGCTCAAAAATATGGATATTTGCTACGAAGATGAAGAGTCAATAAATGGAATAAACCAAATTTTAAATTTAGTAAAGGATATGATAAATATCTTTTCTGCTAAAGTAAATTGGATTATATGAAAATGAGCTATTGAAGTAGCATCTAATTTTAAAAGAACAAGGAAGTAAATTATACTAAATTAATAAACAAGTGAAAGACTCTTACAAAACCGAAAAAGAATTTTATGATCAAATAACTAAAAAATTTTAAGATCAGCAATGCAAAATCGTGAAGAACTCTTTTATAAAATTTAGAATGACTGAAACATTTCAGGAATAAAACAGTAAAAATGATAAAAGTGTTTCAAATGGCTCTACATCTCTTTTATAAACTAATTAAAGCTATATGAATACAACTGCAAACTCATTTAACTTGGTATTAGAAATGTTTAAATGTGAAATAGAGAAGTAAATGATTATGTCTTGCAATAAATGTATTTAATCAATATTGAGTATAACTAATGTGATGAAGCCTTTTGAATTTGAAAGTTTAAAGTCTCAAATTCCCAATTTTATTATTGAAAGAAATAAAATGCAATTAGAAGTGATTGATGAATTTCTAAAACGTTCAAGAGCCTCAAAAGAGATTAATAGCAAAATGATTTCTTAAAATCAATTGACTCATAGCTTTTGCTATCAAAATTTTAAGGAATTTTCATAGTAATTTCAGAGTACTTCATTTTAAAAGAAATAAAAAGAAAGCAGATTTTATAATCATGACTAAGCAATTGCTAATAAATCGCCATTTTCTTTATATGAAACAAATTTTAATCCATTCTCTCAGAATGCAGATATTGAATAATCTAATGTTGAAAAAATAAGTGTTTTGTAAAACATGTAAATTAACAAACTAAAAGAAAAAAATGAGCTCTAAATATCTGAAAAGCAGAGTTTAGCCTAATCTGAAATAAAATATAACTAGACTCCATAAAAATAAAATTTAAACACATCAAAAGAATCAAAACAAAAATTCAATTAAGCATCAAATTAGCAATCAAACTCACCTTATTGCAAAGAATTCTAATTTACCGTACATTAATCAGACCGTTAAAATGATTCATCAAAAGATCAAAAAACCAACTTGAAGAGACAATAAGAAAATAAACAAAATAGTGAATTACACAAATAAGAATGATTTAGTAATGAAAAGGTTTGTTCTAAAGTATAGCTTAAAAATTTGAAGTAAGCTAATAATAATTAACGAGATCAATGATATTTTTTAAGTGATATAATTTTAAAGATAACTTTATTATATGTATGCAATTAAATTTATTTTAGTATGCCAACCATTTTGTGAATTAAATTAATAAAGATCGAATAATTAGATGATTAGTATCTTAGATTTTCCACTAACTCATTTTGGTTGAGATTTTAGGATAATATAAATATCTATCTTTTTTTGGTTTAAATGCCAGATAGTAGTTAATTTCATAACATAATAAATATTGTTGGCTATTTAAGTTTCAGTTATTATTTTGTATTTTTTATCATTAATCATGCTCTTCTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-130.8 L-224.6 L-324.9 S-031.1 S-328.0
S-625.3 S-930.8 S-1228.7 S-1528.8 S-2433.6
C-029.1 C-23,487.8 C-423,231.0 C-625,999.4 C-87,700.3
C-102,558.7 C-121,358.3 C-145,314.3 C-163,492.9 C-18984.6