Summary
Transcript IDgene_000006170
Gene IDTTHERM_00535670TTHERM_00535680
Length1248 bp
Sequence
AATTTCCAAAATTTTTAAGCATGACAAGCGCATAGACTAAAAAAAGCTCCATTGAAAACGATACAGTTTTTAACGGAGAAAAAGAAATTTCTGTTGGTGATATCAGAAAGTTTATTCCTGCAGAATATTTCGTTAAGAGAGAATCCAGATTCTTGATTAGTGTTTTATATTCTTTAAGCTTAACCCTTTTCACAGCTTTCTTAGCTGATAGATATCTCCGTTTAGAATGGGCCTATTTACCTCTCTGGATAGCTTATGCTGTTATCAATGGAACTATTGCTACTGGTCTTTGGGTTTTAGGTCACGAATGTGGTCACAAAGCTTTCTCTAATAGCGATGTTGCTAATGACAGTTTAGGTTATATCCTCCATACTGCTTTATTAGTACCTTACTTCTCTTGGTAATGGTCTCATCATGTTCATCATTCTAAGTGTAACCACTTGACTGAAGGTGAAACTCACGTCCCTAGAGTAGATACTGACCCTAAAGCTTCTATGTATATCAAGCTTAGAGATATTATTGGAGTTGAATCTTTCTCCATCTGGTAAGTTCTTAACATCTTAGTTATCGGATGGCCTGCCTATCTTATTTTTGGTGCTACTGGTGGTCCTGCAAGAGGTTTCAGTAGCCATTTCATTGTTCCTAATAAATTATTCACAAAGGATAAGCTCTTAAAGGTTCACTTATCAAACCTTGGTTTAGTTATTGTAGGATATTTACTCTATCTTTGGGCTAGATAAACTTCTTTCACCTATGTTTTTGCTATCTACTTTGGACCCTACTTAGTCGTTAATGCCTGGTTAACTGGTATCACATTCCTTCAACATACTGAAGATACTGTTCCTCACTATGACAAGTCAGCCTGGAGCTGGTTAAGAGGAGCTTTATGCACTATTGACAGAAACTATCCTGAATACATTAACGCTTTACATTTTGATATTGGTAGCACTCACGTCATTCACCATATTTTCCATGAAATGCCTCACTATAATGCAAGAGAAGCTAATATCTACCTTAAATAAATTCTCGGTCCTGCTTACATTAAAGATAAAAAGTCTGTTACTAGAGCTTTATTTGAAGCTGGTAAATTAGCTTGTGTCTCTGAAAGAGAATAAGGTTTCTATTATTGGAAATGATTTTAATTGTCTATAAAAAAAATTAGAAAAATATTTTAATTATTATTTGATTGGAAGCATAATTTTATGTTTATATATGTAAATTGTGATTCATTTTTCAATAATCTTTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-121,987.5 L-215,339.1 L-38,591.4 S-02,241.0 S-3238.8
S-6158.6 S-9108.6 S-12118.6 S-15135.6 S-24219.3
C-0330.5 C-2434.3 C-4168.2 C-6105.8 C-8689.4
C-10523.0 C-12552.8 C-141,077.3 C-16974.1 C-18419.2