Summary
Transcript IDgene_000006248
Gene IDTTHERM_00481330
Length834 bp
Sequence
GAATAAATAAATAGAAATCTTATTCAATTATCTTAGCGATTATATAAGGAATGGCTTTAAGAAGAGTATTAAAGAATCAATTCAATTTAATTCATAAGGGATAGGCTCAAGCTGTCAGAGGTGGACATGGTTGGGATAGACCTGATGTTCCCCTTAGCTTCAACCCTCTTTATGTTCATAAGCGTGAACTTTCTATCTTCGATACTAATATGTGGATGTACGATTAAGTCTATCCTGAATACGTAATTTCCTATAATGAAATTCATTTAGTTGATTAATGGAAAGGTCTCAAGGAGTCATTTTCTTAATCTGCCTACTGGTGGGCTATGATGGCTATGGTTTTTGGATTCTACTTCATTAACACTACTCCTAGATAACTTGGTATTGATACTAATGACTTAAAGGGTTTCCTTGGTGAATACTATGGTCAATACAAAAAGAGAAGTGGTATTAGATCCAATTTCCTTGGTTTAGATGTCACTGGTGAAAACTCCATCATCCAGCCCAATTATGACAGAAAGAATGGTATCAGAGATGTTATTGACTCTCTTAATGCTGATGCTGGAAAAAGAAAACTCATCAATTTAGAAGCTAAGAACTTTATTGAAAGAGTTGAAAAGGAATGTGAATAACGTATACTCAAGAAAGGTGGTGCTACTTAATCTCACCACTGATTGATTGATTAAGGTTTGCTCAAAACATATGAAATATTAAATTAAAATACTACCTTAATTTAGAAAAGTAGTAGTAAATAATATCTATTAAGTTTGTATTTGTCATGGTTTATAGGAAGTATAAATCTTAATCATTTTTATCTTAAATAGAAAACTTCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-110,456.7 L-210,240.5 L-310,487.2 S-07,374.3 S-35,545.3
S-63,461.1 S-92,736.6 S-123,244.4 S-153,195.9 S-242,208.8
C-01,376.9 C-21,176.5 C-41,099.2 C-61,139.8 C-81,414.5
C-102,310.5 C-122,739.5 C-141,841.7 C-161,564.3 C-181,642.3