Summary
Transcript IDgene_000006249
Gene IDTTHERM_00483490
Length878 bp
Sequence
CGCGAATTAGACAATTAATAAATATTCAAAATAAGAAGAGGTATTTAGGAGGGAAAGAAAACAAACAAACATCAAGTGAAATAGTAGAAATATAAGAAAAAGGAAATGTCAGCAAAAATAAAATCTACTTTAAAGTTTGTCACGGAAACATCAACCAGAAAAGAAGATTATAAAAAAATGAATACAGTATTATAATCACTATTTGATAATAGCGACTCTCTAGAGTTTAGATAACCTGTGGATTACTTAGCTTTAGGATTAACTGACTATCCAAATGTGGTTAAAAAGCCAATGGACTTATCTACTGTTAAAAATAAAATAAATACACAAAGTTATGACACAATAGAAGACTTTTTAGATGATATTTAATTAATTTGGGATAATTGTAAATTATATAATGCTTAAGGATCTTGGATTTGGAAGTTAGCAGATAAATTAGACAAGTACTATAAAAAGCTTATAAAAAATTATTTGCCTATGGTCCAAGTTCAATAAACAGTTGGAAAAAAAGAGAAGAAAGATGATAAAGCAAGCAAATAATAAGATGTGTATATTGATAATTTTTAAGAAGAAAAAAGCTCATTTACTGCTAAAATTAAATAACTTACAGAAGAATAGTTAGGTAGTATAGTAGAATAAATTAGATTAGAAAATCCTTAAGCATTTATAAGATTAGATAATAAAAAGTTATAAGTTATTGTTGATAGCATCAGTTTTGAATCTTTATAAAATTATAATACTTAAATCGATAACTGGTTAATCCCTGTTAAGACTACAAATAAAAGAAGTAAAAATAATTGATAAATGATCTTAATTAAAATACTTAGTTTTATATCATAAAAATTATTTTGAATTTTAATTTTACATGTATGTACCAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,445.7 L-21,415.5 L-3903.2 S-0441.0 S-3312.4
S-6392.6 S-9376.8 S-12278.9 S-15357.3 S-24354.2
C-0231.9 C-2203.8 C-41,299.9 C-61,016.2 C-8345.4
C-10392.9 C-12441.5 C-14664.4 C-16356.8 C-18183.2