Summary
Transcript IDgene_000006363
Gene IDTTHERM_00566830
Length4742 bp
Sequence
AGAGGTTTGATATACTTTACTTAAAAATACTTCAAGTATATCTTCTTGAAAAATGATGATTCATTCAACAGAAGGTGTGAATTCAAATAAAAATTAAAAGGCTATTTTAAGAAAGGGTCATAATCATCCAAATTTATTGAATTAAAGAAATTTATCAGAGTAGAGGAATATTTAATATAAGCCTACATAGCAGCAACATAATGGCTTATTGTTAGAGCATAATATTAGTCAACAAGAAAATATATAATTTAATGTAAATAGAATCCAATAGGGTTCTTCATGTTAGATTTAGTATTTCTTTCCTAAATCAGTTAAAAGAGGAGCAAGAAATAGAACTCCTGGCAATGAAAGTAAAAGTGGATTTTCAATAAATAGCTTGAATGACAATGAATAATAAAACATATTAATTCATGCTAAAAGCGGCGATTGTGATTTTAAAACTACCTAAGCTTAATTCTGCGAAGTTGATATAAATTTGTTGCAAAAGAGAGATATATCAAGGAAACCAGTTTCAAATAGTGTTGCTCAATCTCTGGCTACAAAAAATGTGAATGATTTAATGAATCAACAAAAAAGGTCTTCATCATCAAAAGCAATTTCATCTAATAATACAAATAATTTAATATCTACTCAAGTTATTCTTTAAGAGAGTTAAAATAGTAGATAGTAGATGTCATCTGCTTAAAAAGGATAATCAAGAACTCCTAAAAATAATAAAACAAAATTAAATTCTTAATTAACACCATCTCTTGAAAGAAAGAAGAATTCAAATTCAGTGATTTCAAATAAACGATCAACTTCAATTAACAAGCAAGTAGCTTAATAGCCTAGCTAAGGATCCTAAAAAAAGAATGATAATAAGCCAATAGTTATCCAGTAACAAAGTAAACAACCCTAGCTTAGATTAGCTTCAAAATCTTCCTTATAAAAAAATAGAAAATCTGAGTCTATACGCTACAGGATTAAGACTGTTGGTAACGAAGAAGATGATTCAGATGAGGGATTCAATCCTGAAATTATTAATTTAAATAATTTAGAAGATAATGACACACCATTGAGTAAATTTAAAGATGTTATTCTCTCTAACTAAAAATAACAACCAAGCGATTTATTGAATCCTCCAAGATACCCTCCAAAAATAAAATTTCAAAGAGATGTAGGCAGAGTTCAAGGAAACATCTAGGAGTGCACTGTACTAAAAAATTTCCTAAATTAGGGTGAACATAAGCTACAATAGTAAAAAGGAAATAGTAATTAAAGTATTTAGCTAAAATAAAAAGATGCAACAGATAAATCTCCAAATGCCAAATTAATTAACTCTAAATAAGTAAATATGAGTGGAAATTAGCTTGTAAAAACTGAAAATTAAGGAGTGGAAGTAAATCGAATTAGAGCTATTTCTTCAAACGGTGTAAGAAAAAGAATTTTGACAAAAAGCAATGAAAAGCTAAGAACAAATTTGCATATAAATACAGACAATTATTGTGAAATCGATTTACCTCAATAAAGTTTATATTAAGCTGGTGGAGCAGCCACTACAACTCTAGATTCCAAAGGGTCGACAAAGCATACAAATACTATTAAATTTTCAAGTAGAATAGACACACAAAGTCTGTTCAACAACAATAAAGCTTAGTTAAATAATAATCCAAAATTGGTAAAAGTTAATTCTTCTAGTGATAAAGGTAATTAAAATAGAGCTTAGAGGATAAAAACTGAAGGAGATGAAGTCTCCTTACCAAATTACTCTCCAAGTAATCCAAAGACATACAATGTCAATAACTATTTACATCTTTCTAACAAACTAGAAGAGGATAGATTATTTAAGCAAGATAATTTTCTTGTTTAGTATTAACCTTAAAGTAATAAATCTCATAATAGTGATGTTCTACTTTTTACATCTCAAAAAAAATCTTCAAATAAATCTAACTAAGATATTAAATATTTAGAAAGCGATTAACAAAAATAATGTGCAACAAATTAAGTATAAGAAAATACAATTTAAAGTGATTAAATAATTTCTCCTTAGTTTTAAAAATTAAGATTTAAAAATACTTAAGCTATAACATATGAGAGAAACTATTCTGCAGATGGAACTAGAAACAAATAAAATTAAGATCTTAATAGCAATTTAAAATAATTAAAGAAAAAAAAATTAATGATAAAAACTATTAATCCATATAAATCAGAAGAGAAAAAGGAAATTTCTTCTTAATCTGAAACCCCATCTAGCGCTCATAGCTCAATTATGTTCAGTAGTATTGGAAACAATAATGGAATATTAACTAAAAATACTGATACTTTCTCTAAAAGTCCTTTGAGTTTAAGGAAATCAGATGGTGTTAATATTGTGAAAAGCCACAATTAGTAAGGAATACTATAATCTCAGTTTAGTAGTGGCTAATAAAATTTTGAAAACCAATAAAATGTGAGAGAAAGCATAGCAAGTGATTATTAATCTAATTAAATTTATCAGAGTGTTTAACATAATTATTCTAGTAAAAAAATGGTTGATTGGATAGAAATAACAAGCCCAAACAACATCCATTTAAGCTCTGATTAAAACTCTAATGCAATTATAGATAATAAGAAACAACAAAAAATCATGCTACGTCCAACAAAAGTTACATCAAACGAAAGAAAAAATAACAATAATAGTAGTAATGGAAGCAGATCACAAATAAAATAATTATGCAACACTAACTCAAATAATAACATACTTTAATCTTCATAAAATATAGCAAATAATCAAATTTTATATAATAGTAATAATTAATAAATTAATTAAAAGGGTTATTTTTCCGTTCCTATGCAGCTAATAGCAGCTCCTTAGCAAAATCTTTACTAGGAAAGTGGTTAGTAGAAAAATTACTTTTCATCCCAAAAATTTACAAACGAATTTCGACTCTCTGTTGAGACATTTCAGCCTTCAGAAAAAAAAGATAAAAATTAATCTACAAACTCTCTTTTATCTTCATCTAACAATAATAATCCCAATTTTAATATAATTTTCAACTCCAATAAATCAAATGATGCTAAGGAACTAAAAACAATAAAATAACAGATAAATTTTTATTCTAATATTGATGAGGATTAATAAAAGCAAAAATAAATTTTAGATTCCATAAAATCTGATGCAATGAAAAGCATATTGAGATAATCCTTAGAAAAAGGAAAAGATTAATCACAATTCTAATCAGATTCTATCTAAGAATTGTAAAAAGACCTCCATGAAATGAAACTAAATGTTTAAATAGAAAATATGAATTAAAATTTTGCTACTTTAAATAAAAACTTGAAGGAAATGAACAATGACTTAAATTTAGAATACTCAAATATCATTCCAAGAGATTCTAGAAGTAATATTTTAGAAAATATAGACAGCTATCATTTTGATAAAATTCCAGAAAATGATAGTAATAATCATTCTAAAAGTATAATTAATTGTCACGTTAGTATTTTAAATAATAACTAGTAGGATTCTTTTAAATACACAAACGAAACAAGCTAAAATGATAATTAACAAGCTGAAAAAATGCAGTAACTAGTTAATAATTTTGATTTTTCTGATATTTAAGAGGGACCTGATGATAAAGATATTATGTCGTAATTAGAAAAAGAAAAAACTGAGTTTGAGTAAAAGCTATTGTAAGAAAAAATAAAATTTGAACAAAGATAGCAGCAATTAAAATAAGAGTTCATTTATTAAAAATAAAAACTGATTTAGTAACAGTAAATGAGACTAAAAAATAGCAATGGGCAAGCTAGCTCAGTAAAAAATTAATTTGAATAAAATTAATCTAAAAACAACAGCTTACAAAATAAAGAAGATAATTTTGCTCTTTCTCCTTTTTCTAGTTAAGAACAACAAGACGTAAAAGAACAAAACCATAACTAGTAAAGATAAAATTTAAATATGAAAAAAAATAACTCTTTTACACAATATCCTAGTAACTGTGGATAAAAAATGTTGTAATTTGCTGATAAAAGCTTAGACTTAAGCTTCACTAAAAATCCGAATTTAGAAAATGATGTTTCAAAGCTATTTAGACAAGAATAGATAAGTCAAATACTTCCTGAGAGTTAATGCTCTTTCCTAAGCGAGGTCGAAAATATATTAGAAACTAATAACAACTCTAATTTATTTACAAATGGAGGAAACTAAGCCATGAAAAATTAAAATATTCATTAAGGTTTTAACTAAGATGGAATAAATGTAATAAACCTATAAAACTAATCTTCAGCAAAAAATATCAGCCAAAGTACTAAGTTCTAAGAAAATCAATCAGCAATATAAAAGTAAAACTTTTTCCCTACTATCAGTCCTCAATCTTCCTCTTAAAGTTTATCAGATAAATAATATAAGCACATGAATTCTAATAATTAACAATTTCCTAATATTCATATAAATGCAAATATGGTTAACATTCCTAAATAATAAAGAAAGAATAATTTTTAAATACATGAATAAATTTAATAATAGCTAGTTATTGAAGAGCAAGATTGTGAGCAATCTTAAGACTCATCAATACAGATATAATACCATCAATAAAACAAAATTGCCAATTTCAATTCATAAAATTCAAATAGAATGCCTCCTCTTCCTCTTAATGTAGGATAACTTCAAAAATTAAAAAAAAATAATTTATGCTAAACTTCATAAAAATTTTCAAACTTAAAGAATTGATTTATTAATGAATTCAAATTCATTGAATTGAAAATAAAAAACATTTTTAACAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1220.3 L-2193.8 L-3187.1 S-0214.7 S-3222.0
S-6126.2 S-9191.8 S-12219.1 S-15193.6 S-24336.6
C-0207.7 C-26,615.1 C-42,575.9 C-62,018.2 C-8861.5
C-10647.7 C-121,290.3 C-14716.6 C-16395.8 C-18469.6