Summary
Transcript IDgene_000006517
Gene IDTTHERM_00614720
Length780 bp
Sequence
AAAATTTAAGACAAAAACGAAAAAGAAATTAAGCTTAGGGCAAGAGAGAGTTAATAAGTTAAAAATAGAATATTTCTTTGTAAAGTTAAAATATACTAGCTATAGATTTATAATAAAAATGGGAAACGTATGCGGAGGATCTTCACAATCATCATCTAGTAGTAAAAGCTAGAGAGCATTAAGATTAAGGGATGAAAAAAAACCAGCATAATAGGCAAAAGTAGTATTATTAGGAAATATAGCAGTAGGAAAAACTGCAATCACTCAAAGATTTAAATAAGGAATATTTGATCCAGCCCACCAAGCAACATTAGGAGCAGCATACATAGAAAAAAATATTACATTATAAGATAATTCCGTTTTGTCTTTGCATATTTGGGATACAGCAGGAGATGAAAGATATCGCTCAATCCTTTCCATGTTTTATAGAGATTCTTAGGCAGCCATTTTAGTTTATGATGTGACTGATGCAGATAGTTTCAATAGTTTGTAATTATGGATAAACGAGCTTGAAGATAAAGCAAAAACAGAAGGCATGATTATAGCTCTAGTTGGTAATAAAATAGATTCACCTTATGAAATGGTAAAAGTTTCAACATAGAAGGCAGAGCAATTTGCTAGAGAGAAAAACTTCTTGTTTACTGAGTGTTCAGCCAAAACAGGAGAAGGAATAGATAGAATATTTAATATGATAGTTGAAGAATTAATAAAAAAGAAAAAATCAGAGCATAACTGATCCAATTTTTTAGTAAAATAATTAAAAGAAATCTTTATTTAGCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,409.4 L-23,942.3 L-33,613.0 S-05,190.5 S-33,797.9
S-64,972.9 S-95,232.3 S-125,052.4 S-155,052.9 S-245,042.8
C-04,139.1 C-23,571.6 C-41,942.0 C-61,813.6 C-81,670.7
C-103,462.2 C-123,390.8 C-144,052.4 C-163,726.0 C-184,421.8