Summary
Transcript IDgene_000006532
Gene IDTTHERM_00616330
Length1059 bp
Sequence
AAATTATAAATATCTTTTAAAATAACAAACAAAAACTATAAAAGACACTTTTTATAAAATGTAGGTAAAGGCAATATAAAATTAAACTTTATACAATCTTATCTAGGATTTAAGACATATTGTACTAATTTAGTTATCGAAAAATGAAAAAAATGATCATTTAAGATAGGCAGTCAGATTCGACTTTGAAACTTCAAAACCAGCTGAAATACTTGAGTTGATTCATGATATGGATTAAAAAGCTATATAAAACGAGTAAAAGTATAAGTTATAAAAAATTAGAAGAATTTGCTTTATTGACTATGATCCTCTTGAGGAAAAAGACAAAAAATTGGAAAAATATCTTCAGTTATTTAGCAATGAGAAGACCTTGGCTGAATATAAGTTTTACTGTCTTAAAGAGGGACTAAATAGTTTTTCTAAAAAGTATCCATTTTTGATGTTAAATAACGATGATTTCGAGAACATAGAAGAAAAGAAGAAAGAAGCACCTAAAGATTCAAGGGATATTTTAAATGATAAATAAAAAAAGGTTTTATATTCTTATAGTTAATTTCCTTTTGAAATAGTAGAAGATGTGCTATTCTTGGGTAATGTATATCACTCAAACAGCTAAATGTATTTGAATGACTTAAGCATCAAGATAATGATTGATTTTATTACATATAGTGAAGAAGATACTTAAAAAATACCTTCTTTTAAGACTGAAAAATTTGAATATAAAAATATTCCCCTTGATGCCAAACAGTCAGTCACCTTAGATTTTGATGAAATTAACAAATATATAGAGTAATAAATCAGTGAAAATAAAGGAAGAGTTCTTCTATATTGTTCAAATGGCTAATCAATAAGTCCTGCATTTGCTATATCCTATTTAATGTACAAACAAAAAATGAACATATAACTAGCAAGTATGAAAGTGTTTGCTTTAATAGGCAAAGTGAATATCGCTTAGTGGATATATACTTAATTATTAGTTTACAAACCAAAATATTGATATCAATTAACTAAAGTTATTTCTGTTATATAAAATATATTTATTCTACTGCAATAGTTATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,103.7 L-21,252.4 L-3838.5 S-02,193.0 S-3803.2
S-61,007.2 S-91,412.3 S-121,745.5 S-151,822.2 S-241,439.1
C-0295.2 C-21,406.3 C-42,131.2 C-61,413.6 C-8981.4
C-101,775.7 C-121,313.5 C-141,118.4 C-161,047.3 C-181,569.4